Bumps

Author: cmdcolin

README.md

@@ -171,7 +171,6 @@ Class of each CRAM record returned by this API.
 ##### Parameters
 
 - `$0` **any** 
-
   - `$0.flags`  
   - `$0.cramFlags`  
   - `$0.readLength`  
@@ -313,7 +312,6 @@ the actual substituted and reference base pairs, and will make the
 
 - `refRegion`
   **[object](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Object)** 
-
   - `refRegion.start`
     **[number](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Number)** 
   - `refRegion.end`
@@ -360,7 +358,6 @@ that show insertions, deletions, substitutions, etc.
 
 - `args`
   **[object](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Object)** 
-
   - `args.cram` **CramFile** 
   - `args.index` **Index-like** object that supports
     getEntriesForRange(seqId,start,end) -> Promise\[Array\[index entries]]
@@ -440,7 +437,6 @@ Returns
 
 - `args`
   **[object](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Object)** 
-
   - `args.path`
     **[string](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/String)?** 
   - `args.url`

package.json

@@ -65,7 +65,7 @@
     "documentation": "^14.0.3",
     "eslint": "^9.29.0",
     "eslint-plugin-import": "^2.31.0",
-    "eslint-plugin-unicorn": "^59.0.0",
+    "eslint-plugin-unicorn": "^60.0.0",
     "mock-fs": "^5.2.0",
     "prettier": "^3.2.5",
     "rimraf": "^6.0.1",

src/cramFile/file.ts

@@ -110,12 +110,15 @@ export default class CramFile {
     const { maxLength, parser } = cramFileDefinition()
     const headbytes = await this.file.read(maxLength, 0)
     const definition = parser(headbytes).value
-    if (definition.majorVersion !== 2 && definition.majorVersion !== 3) {
+    if (definition.magic !== 'CRAM') {
+      throw new Error('Not a CRAM file, does not match magic string')
+    } else if (definition.majorVersion !== 2 && definition.majorVersion !== 3) {
       throw new CramUnimplementedError(
         `CRAM version ${definition.majorVersion} not supported`,
       )
+    } else {
+      return definition
     }
-    return definition
   }
 
   // memoize

test/data/hts-specs/cram/3.0/README.md

@@ -4,7 +4,6 @@ Try to test in order, so early tests don't require correct interpretation of
 later tests. This gives an ordering for software development and testing.
 
 - Data types
-
   - ITF8
   - Strings
   - Arrays
@@ -65,7 +64,6 @@ An empty file to check the file definition can be read. We require a SAM header
 too, but this is also empty (using one block, see below).
 
 - Empty CRAM file (failed/0000_empty_noref.cram)
-
   - File definition
   - SAM header container (zero content)
   - [End of file; no EOF block so may emit warning]
@@ -79,7 +77,6 @@ too, but this is also empty (using one block, see below).
   warning or a hard error.)
 
 - Empty CRAM file with EOF block (0001_empty_eof.cram)
-
   - As above, but with official EOF block.
 
     This EOF block can be decoded either by checking for a specific series of
@@ -127,23 +124,19 @@ c->num_landmarks=0 set c->curr_slice=0 set c->length=181 c ]
 Files with 1 or more sequences. These are all unmapped with no auxiliary tags.
 
 - Single read (0300_unmapped.cram)
-
   - Tests decoded data via EXTERNAL, HUFFMAN, BYTE_ARRAY_STOP and BYTE_ARRAY_LEN
     encodings.
   - 4 blocks in slice (CORE - empty, RN, QS, BA).
 
 - Two unpaired reads, of differing length (0301_unmapped_cram)
-
   - As above, but RL is no longer a constant and is in its own block.
 
 - Three reads, including a pair (0302_unmapped_cram)
-
   - Also contains BF and MF blocks. All still CF "detached".
   - BF 77 & 141 match the input SAM, but this is redundant as it's
   - also set in MF bit 2.
 
 - Three reads, including a pair (0303_unmapped_cram)
-
   - As above, but the SAM FLAGs of 77 and 141 are stored as 69 and 133 (clearing
     mate unmapped flag). BF + MF are sufficient to regenerate the correct FLAG
     field.
@@ -154,21 +147,18 @@ Files with 1 or more sequences. These are all unmapped with no auxiliary tags.
 ## Slice basics, mapped reads, no reference
 
 - Single read (0400_mapped.cram)
-
   - Container ref id, pos and span, number of records and number of bases fields
     are changed.
   - Checks that mapped data can process MD5 0, provided container RR=0.
   - Additional data series in use: FN, FP, FC, MQ.
   - One feature of type 'b', with sequence stored in BB.
 
 - Paired reads, but detached (0401_mapped.cram)
-
   - RNEXT/PNEXT/TLEN of \*/0/0
   - Explicit TS, NP, NS with constant values as they would disagree with
     auto-computed values.
 
 - Paired reads, but detached (0402_mapped.cram)
-
   - RNEXT/PNEXT/TLEN filled out.
   - Explicit TS, NP, NS, with non-constant values [ Edit htslib to force
     bam_ins_size check to fail and hence "goto detached". ]
@@ -183,23 +173,20 @@ Testing of the FC (Feature Codes) data series types and their associated
 type-specific data series.
 
 - External reference, CIGAR ops (0500_mapped.cram)
-
   - No edits: entirely match reference
   - No FP/FC needed (and FN=0).
   - Sequence is implicitly assumed to entirely match reference
   - Header gains an @SQ UR: tag, although note this pathname is local and not
     transferable to other systems.
 
 - External reference, CIGAR ops (0501_mapped.cram)
-
   - Mismatching first and last base on first seq and first / last 3 bases on
     second seq.
   - Adds use of FC "X" and the BS (base substitution) data series. This tests
     the compression header "SM" preservation map. Note BB data series has an
     encoding in the compression header, but is not used here.
 
 - As above, but R/Y bases (0502_mapped.cram).
-
   - Test of the BA data series and FC "B" code. BS (base substitution) only
     applies for A, C, G, T, N.
 
@@ -213,19 +200,16 @@ type-specific data series.
     s->block[12]->data[0].]
 
 - As above with R/Y bases, using using "b" FC (0503_mapped.cram).
-
   - Unlike FC "B", "b" is a string instead of a single character and doesn't
     require storing quality data.
 
     [ Produced by changing the "if (0 && CRAM_MAJOR_VERS...)" line in
     process_one_read().]
 
 - Soft/hard clips (0504_mapped.cram)
-
   - FC codes S and H, with associated SC and HC data series.
 
 - Indels (0505_mapped.cram)
-
   - Tests FC codes and data-series: D (DL), I (IN) and i (BA). The table below
     shows cigar ops, with "m" being lowercase as it's not explicitly stored in
     CRAM. The FC row shows the associated CRAM feature code. REF
@@ -237,7 +221,6 @@ type-specific data series.
     FC D D I i
 
 - As above, but explicit padding in the 5bp indel (0506_mapped.cram)
-
   - Tests FC code P and data series PD REF
     ATTTTTCGGGTTTTTTGAAATGAATATCGTAGCTACAGAAACGGTTGTGCACTCATCTGAAAGTTTGTTT T
     TCTTGTTTTCTTGCACTTTGTGCAGAATT SEQ ATTTTTCGGGTTTTTTGAAA AT
@@ -405,15 +388,12 @@ examples produced by some current implementations.
 - BETA (already tested in 1101_BETA.cram)
 
 - SUBEXPONENTIAL
-
   - I have no code to write this data format. Exists in htsjdk though?
 
 - GAMMA
-
   - I have no code to write this data format. Exists in htsjdk though?
 
 - GOLOMB (deprecated)
-
   - I have no code to read nor write this data format
 
 - GOLOMB-RICE (deprecated)
@@ -422,19 +402,16 @@ examples produced by some current implementations.
 ## Index
 
 - Simple mapped case (1400_index_simple.cram)
-
   - 10bp reads starting one per base. Read name indicates bases covered.
   - 77 reads per container
   - Index query CHROMOSOME_I:333-444 should return 121 records, from s324-333 to
     s444-453
 
 - Unmapped data (1401_index_unmapped.cram)
-
   - As above, but all data is unmapped
   - Index query for unmapped (eg ref `*`) should return all 1000 records.
 
 - Multiple references + unmapped (1402_index_3ref.cram)
-
   - 300 for first ref, 10 for second, 300 for third, and 300 unmapped.
   - Only one reference per slice.
   - CHROMOSOME_I:100-200 returns 110 records
@@ -445,7 +422,6 @@ examples produced by some current implementations.
   - `*` (unmapped) returns 300 records
 
 - Multi-ref mode (1403_index_multiref.cram)
-
   - As above, but containers / slices use the RI data series with multiple
     references per container. The same queries will work as above.
   - Hence index reports reference IDs, but multiple references can occur at the
@@ -459,17 +435,14 @@ examples produced by some current implementations.
     container as the last reads in ref 2.
 
 - Multi-slice containers (1404_index_multislice.cram)
-
   - As 1402_index_3ref.cram, but 3 slices per container.
   - Same queries will work as above.
 
 - Multi-slice multi-ref containers (1405_index_multisliceref.cram)
-
   - As above, but with multiple references permitted per slice.
   - Same queries will work as above.
 
 - Mix of long and short reads
-
   - 10bp reads starting every position
   - 350bp reads starting every 300 positions