From 9fb33bc8e995afab7b52ad6bfba0cb178a179c0d Mon Sep 17 00:00:00 2001 From: <> Date: Sun, 28 Jul 2024 03:56:08 +0000 Subject: [PATCH] Deployed 099ece9 with MkDocs version: 1.6.0 --- .nojekyll | 0 01-introduction/index.html | 944 +++ 02-the-filesystem/index.html | 1000 +++ 03-working-with-files/index.html | 1310 ++++ 04-redirection/index.html | 1404 ++++ 05-writing-scripts/index.html | 1302 ++++ 06-organization/index.html | 1028 +++ 404.html | 478 ++ assets/images/favicon.png | Bin 0 -> 1870 bytes assets/javascripts/bundle.fe8b6f2b.min.js | 29 + assets/javascripts/bundle.fe8b6f2b.min.js.map | 7 + assets/javascripts/glightbox.min.js | 1 + assets/javascripts/lunr/min/lunr.ar.min.js | 1 + assets/javascripts/lunr/min/lunr.da.min.js | 18 + assets/javascripts/lunr/min/lunr.de.min.js | 18 + assets/javascripts/lunr/min/lunr.du.min.js | 18 + assets/javascripts/lunr/min/lunr.el.min.js | 1 + assets/javascripts/lunr/min/lunr.es.min.js | 18 + assets/javascripts/lunr/min/lunr.fi.min.js | 18 + assets/javascripts/lunr/min/lunr.fr.min.js | 18 + assets/javascripts/lunr/min/lunr.he.min.js | 1 + assets/javascripts/lunr/min/lunr.hi.min.js | 1 + assets/javascripts/lunr/min/lunr.hu.min.js | 18 + assets/javascripts/lunr/min/lunr.hy.min.js | 1 + assets/javascripts/lunr/min/lunr.it.min.js | 18 + assets/javascripts/lunr/min/lunr.ja.min.js | 1 + assets/javascripts/lunr/min/lunr.jp.min.js | 1 + assets/javascripts/lunr/min/lunr.kn.min.js | 1 + assets/javascripts/lunr/min/lunr.ko.min.js | 1 + assets/javascripts/lunr/min/lunr.multi.min.js | 1 + assets/javascripts/lunr/min/lunr.nl.min.js | 18 + assets/javascripts/lunr/min/lunr.no.min.js | 18 + assets/javascripts/lunr/min/lunr.pt.min.js | 18 + assets/javascripts/lunr/min/lunr.ro.min.js | 18 + assets/javascripts/lunr/min/lunr.ru.min.js | 18 + assets/javascripts/lunr/min/lunr.sa.min.js | 1 + .../lunr/min/lunr.stemmer.support.min.js | 1 + assets/javascripts/lunr/min/lunr.sv.min.js | 18 + assets/javascripts/lunr/min/lunr.ta.min.js | 1 + assets/javascripts/lunr/min/lunr.te.min.js | 1 + assets/javascripts/lunr/min/lunr.th.min.js | 1 + assets/javascripts/lunr/min/lunr.tr.min.js | 18 + assets/javascripts/lunr/min/lunr.vi.min.js | 1 + assets/javascripts/lunr/min/lunr.zh.min.js | 1 + assets/javascripts/lunr/tinyseg.js | 206 + assets/javascripts/lunr/wordcut.js | 6708 +++++++++++++++++ .../workers/search.b8dbb3d2.min.js | 42 + .../workers/search.b8dbb3d2.min.js.map | 7 + assets/stylesheets/glightbox.min.css | 1 + assets/stylesheets/main.3cba04c6.min.css | 1 + assets/stylesheets/main.3cba04c6.min.css.map | 1 + assets/stylesheets/palette.06af60db.min.css | 1 + .../stylesheets/palette.06af60db.min.css.map | 1 + fig/DC1_logo_small.png | Bin 0 -> 7407 bytes fig/DataONE_LOGO.jpg | Bin 0 -> 13000 bytes fig/Slide1.jpg | Bin 0 -> 26261 bytes fig/bootcamps/2012-11-scripps.png | Bin 0 -> 394282 bytes fig/bootcamps/2012-12-uta.png | Bin 0 -> 180758 bytes fig/bootcamps/2013-01-mcgill.png | Bin 0 -> 246164 bytes fig/bootcamps/2013-01-mckellar.png | Bin 0 -> 643453 bytes fig/creative-commons-attribution-license.png | Bin 0 -> 4739 bytes fig/filesystem-challenge.svg | 763 ++ fig/icon.png | Bin 0 -> 673500 bytes fig/lessons/swc-shell/absolute_path.png | Bin 0 -> 18982 bytes .../swc-shell/absolute_relative_path.png | Bin 0 -> 44812 bytes fig/lessons/swc-shell/command_shell.svg | 921 +++ fig/lessons/swc-shell/decwriter.jpg | Bin 0 -> 26459 bytes fig/lessons/swc-shell/direct_shell_usage.png | Bin 0 -> 37447 bytes fig/lessons/swc-shell/filedir_challenge.png | Bin 0 -> 103988 bytes fig/lessons/swc-shell/filesystem.png | Bin 0 -> 13194 bytes fig/lessons/swc-shell/find_file_tree.png | Bin 0 -> 29870 bytes fig/lessons/swc-shell/google_vs_grep.png | Bin 0 -> 38921 bytes fig/lessons/swc-shell/home_directories.png | Bin 0 -> 9869 bytes fig/lessons/swc-shell/nano.png | Bin 0 -> 20257 bytes fig/lessons/swc-shell/nano_quotation.png | Bin 0 -> 24493 bytes fig/lessons/swc-shell/permissions_table.png | Bin 0 -> 35138 bytes .../swc-shell/process_stdin_stdout.png | Bin 0 -> 10887 bytes fig/lessons/swc-shell/public_private_keys.png | Bin 0 -> 55180 bytes fig/lessons/swc-shell/relative_path.png | Bin 0 -> 6523 bytes fig/lessons/swc-shell/remote_shell_usage.png | Bin 0 -> 48939 bytes fig/lessons/swc-shell/running_a_process.png | Bin 0 -> 32948 bytes fig/lessons/swc-shell/running_wc.png | Bin 0 -> 40639 bytes fig/lessons/swc-shell/running_wc_sort.png | Bin 0 -> 43098 bytes .../swc-shell/running_wc_sort_head.png | Bin 0 -> 48516 bytes fig/lessons/swc-shell/shell_as_process.png | Bin 0 -> 30642 bytes fig/lessons/swc-shell/shell_on_shell.png | Bin 0 -> 35443 bytes fig/lessons/swc-shell/vlad_homedir.png | Bin 0 -> 29836 bytes fig/lessons/swc-shell/x_for_directories.png | Bin 0 -> 31426 bytes fig/nano201711.png | Bin 0 -> 30090 bytes fig/nesi_ga.png | Bin 0 -> 192252 bytes fig/nesi_images/Login_jupyterhubNeSI.png | Bin 0 -> 45128 bytes .../ServerOptions_jupyterhubNeSI.png | Bin 0 -> 54530 bytes fig/nesi_images/download.png | Bin 0 -> 74007 bytes fig/nesi_images/ga-vl01jupyterhubNeSI.png | Bin 0 -> 59278 bytes fig/nesi_images/jupyter_launcher.png | Bin 0 -> 112215 bytes fig/nesi_images/upload.png | Bin 0 -> 30955 bytes fig/readme/step1.png | Bin 0 -> 12411 bytes fig/readme/step2.png | Bin 0 -> 19371 bytes fig/readme/step3.png | Bin 0 -> 32063 bytes fig/readme/steps-src.svg | 423 ++ fig/rss-icon-blue.png | Bin 0 -> 1367 bytes fig/rwx_figure.svg | 291 + fig/setup/cygwin-icon.jpg | Bin 0 -> 2996 bytes fig/setup/cygwin-terminal-300x175.jpg | Bin 0 -> 10439 bytes fig/setup/gnome-terminal-300x195.jpg | Bin 0 -> 6780 bytes fig/setup/mac-terminal-300x257.jpg | Bin 0 -> 9190 bytes fig/setup/ubuntu-terminal-300x197.jpg | Bin 0 -> 15459 bytes fig/site/main_shadow.png | Bin 0 -> 863 bytes fig/slides/enrolment.png | Bin 0 -> 20178 bytes fig/slides/workshops.png | Bin 0 -> 18221 bytes fig/software-carpentry-banner.png | Bin 0 -> 8535 bytes index.html | 626 ++ javascripts/mathjax.js | 17 + search/search_index.json | 1 + sitemap.xml | 38 + sitemap.xml.gz | Bin 0 -> 300 bytes stylesheets/extra.css | 1032 +++ 117 files changed, 18870 insertions(+) create mode 100644 .nojekyll create mode 100644 01-introduction/index.html create mode 100644 02-the-filesystem/index.html create mode 100644 03-working-with-files/index.html create mode 100644 04-redirection/index.html create mode 100644 05-writing-scripts/index.html create mode 100644 06-organization/index.html create mode 100644 404.html create mode 100644 assets/images/favicon.png create mode 100644 assets/javascripts/bundle.fe8b6f2b.min.js create mode 100644 assets/javascripts/bundle.fe8b6f2b.min.js.map create mode 100644 assets/javascripts/glightbox.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ar.min.js create mode 100644 assets/javascripts/lunr/min/lunr.da.min.js create mode 100644 assets/javascripts/lunr/min/lunr.de.min.js create mode 100644 assets/javascripts/lunr/min/lunr.du.min.js create mode 100644 assets/javascripts/lunr/min/lunr.el.min.js create mode 100644 assets/javascripts/lunr/min/lunr.es.min.js create mode 100644 assets/javascripts/lunr/min/lunr.fi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.fr.min.js create mode 100644 assets/javascripts/lunr/min/lunr.he.min.js create mode 100644 assets/javascripts/lunr/min/lunr.hi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.hu.min.js create mode 100644 assets/javascripts/lunr/min/lunr.hy.min.js create mode 100644 assets/javascripts/lunr/min/lunr.it.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ja.min.js create mode 100644 assets/javascripts/lunr/min/lunr.jp.min.js create mode 100644 assets/javascripts/lunr/min/lunr.kn.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ko.min.js create mode 100644 assets/javascripts/lunr/min/lunr.multi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.nl.min.js create mode 100644 assets/javascripts/lunr/min/lunr.no.min.js create mode 100644 assets/javascripts/lunr/min/lunr.pt.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ro.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ru.min.js create mode 100644 assets/javascripts/lunr/min/lunr.sa.min.js create mode 100644 assets/javascripts/lunr/min/lunr.stemmer.support.min.js create mode 100644 assets/javascripts/lunr/min/lunr.sv.min.js create mode 100644 assets/javascripts/lunr/min/lunr.ta.min.js create mode 100644 assets/javascripts/lunr/min/lunr.te.min.js create mode 100644 assets/javascripts/lunr/min/lunr.th.min.js create mode 100644 assets/javascripts/lunr/min/lunr.tr.min.js create mode 100644 assets/javascripts/lunr/min/lunr.vi.min.js create mode 100644 assets/javascripts/lunr/min/lunr.zh.min.js create mode 100644 assets/javascripts/lunr/tinyseg.js create mode 100644 assets/javascripts/lunr/wordcut.js create mode 100644 assets/javascripts/workers/search.b8dbb3d2.min.js create mode 100644 assets/javascripts/workers/search.b8dbb3d2.min.js.map create mode 100644 assets/stylesheets/glightbox.min.css create mode 100644 assets/stylesheets/main.3cba04c6.min.css create mode 100644 assets/stylesheets/main.3cba04c6.min.css.map create mode 100644 assets/stylesheets/palette.06af60db.min.css create mode 100644 assets/stylesheets/palette.06af60db.min.css.map create mode 100644 fig/DC1_logo_small.png create mode 100644 fig/DataONE_LOGO.jpg create mode 100644 fig/Slide1.jpg create mode 100644 fig/bootcamps/2012-11-scripps.png create mode 100644 fig/bootcamps/2012-12-uta.png create mode 100644 fig/bootcamps/2013-01-mcgill.png create mode 100644 fig/bootcamps/2013-01-mckellar.png create mode 100644 fig/creative-commons-attribution-license.png create mode 100644 fig/filesystem-challenge.svg create mode 100644 fig/icon.png create mode 100644 fig/lessons/swc-shell/absolute_path.png create mode 100644 fig/lessons/swc-shell/absolute_relative_path.png create mode 100644 fig/lessons/swc-shell/command_shell.svg create mode 100644 fig/lessons/swc-shell/decwriter.jpg create mode 100644 fig/lessons/swc-shell/direct_shell_usage.png create mode 100644 fig/lessons/swc-shell/filedir_challenge.png create mode 100644 fig/lessons/swc-shell/filesystem.png create mode 100644 fig/lessons/swc-shell/find_file_tree.png create mode 100644 fig/lessons/swc-shell/google_vs_grep.png create mode 100644 fig/lessons/swc-shell/home_directories.png create mode 100644 fig/lessons/swc-shell/nano.png create mode 100644 fig/lessons/swc-shell/nano_quotation.png create mode 100644 fig/lessons/swc-shell/permissions_table.png create mode 100644 fig/lessons/swc-shell/process_stdin_stdout.png create mode 100644 fig/lessons/swc-shell/public_private_keys.png create mode 100644 fig/lessons/swc-shell/relative_path.png create mode 100644 fig/lessons/swc-shell/remote_shell_usage.png create mode 100644 fig/lessons/swc-shell/running_a_process.png create mode 100644 fig/lessons/swc-shell/running_wc.png create mode 100644 fig/lessons/swc-shell/running_wc_sort.png create mode 100644 fig/lessons/swc-shell/running_wc_sort_head.png create mode 100644 fig/lessons/swc-shell/shell_as_process.png create mode 100644 fig/lessons/swc-shell/shell_on_shell.png create mode 100644 fig/lessons/swc-shell/vlad_homedir.png create mode 100644 fig/lessons/swc-shell/x_for_directories.png create mode 100644 fig/nano201711.png create mode 100644 fig/nesi_ga.png create mode 100644 fig/nesi_images/Login_jupyterhubNeSI.png create mode 100644 fig/nesi_images/ServerOptions_jupyterhubNeSI.png create mode 100644 fig/nesi_images/download.png create mode 100644 fig/nesi_images/ga-vl01jupyterhubNeSI.png create mode 100644 fig/nesi_images/jupyter_launcher.png create mode 100644 fig/nesi_images/upload.png create mode 100644 fig/readme/step1.png create mode 100644 fig/readme/step2.png create mode 100644 fig/readme/step3.png create mode 100644 fig/readme/steps-src.svg create mode 100644 fig/rss-icon-blue.png create mode 100644 fig/rwx_figure.svg create mode 100644 fig/setup/cygwin-icon.jpg create mode 100644 fig/setup/cygwin-terminal-300x175.jpg create mode 100644 fig/setup/gnome-terminal-300x195.jpg create mode 100644 fig/setup/mac-terminal-300x257.jpg create mode 100644 fig/setup/ubuntu-terminal-300x197.jpg create mode 100644 fig/site/main_shadow.png create mode 100644 fig/slides/enrolment.png create mode 100644 fig/slides/workshops.png create mode 100644 fig/software-carpentry-banner.png create mode 100644 index.html create mode 100644 javascripts/mathjax.js create mode 100644 search/search_index.json create mode 100644 sitemap.xml create mode 100644 sitemap.xml.gz create mode 100644 stylesheets/extra.css diff --git a/.nojekyll b/.nojekyll new file mode 100644 index 0000000..e69de29 diff --git a/01-introduction/index.html b/01-introduction/index.html new file mode 100644 index 0000000..82d5746 --- /dev/null +++ b/01-introduction/index.html @@ -0,0 +1,944 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + 1. Introducing the Shell - Introduction to Shell for Bioinformatics + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + + + +
+ + +
+ +
+ + + + + + +
+
+ + + +
+
+
+ + + + + +
+
+
+ + + +
+
+
+ + + +
+
+
+ + + +
+
+ + + + + + + +

1. Introducing the Shell

+
+

Lesson Objectives

+
    +
  • Describe key reasons for learning shell.
  • +
  • Navigate your file system using the command line.
  • +
  • Access and read help files for bash programs and use help files to identify useful command options.
  • +
  • Demonstrate the use of tab completion, and explain its advantages.
  • +
+
+
+

questions

+
    +
  • What is a command shell and why would I use one?
  • +
  • How can I move around on my computer?
  • +
  • How can I see what files and directories I have?
  • +
  • How can I specify the location of a file or directory on my computer?
  • +
+
+

This lesson has been adapted from the original Data Carpentry - Shell Genomics to be run using the NeSI infrastructure as part of the Otago Bioinformatics Spring School instead of AWS.

+

What is a shell and why should I care?

+

A shell is a computer program that presents a command line interface +which allows you to control your computer using commands entered +with a keyboard instead of controlling graphical user interfaces +(GUIs) with a mouse/keyboard/touchscreen combination.

+

There are many reasons to learn about the shell:

+
    +
  • Many bioinformatics tools can only be used through a command line interface. Many more + have features and parameter options which are not available in the GUI. + BLAST is an example. Many of the advanced functions are only accessible + to users who know how to use a shell.
  • +
  • The shell makes your work less boring. In bioinformatics you often need to repeat tasks with a large number of files. With the shell, you can automate those repetitive tasks and leave you free to do more exciting things.
  • +
  • The shell makes your work less error-prone. When humans do the same thing a hundred different times + (or even ten times), they're likely to make a mistake. Your computer can do the same thing a thousand times + with no mistakes.
  • +
  • The shell makes your work more reproducible. When you carry out your work in the command-line + (rather than a GUI), your computer keeps a record of every step that you've carried out, which you can use + to re-do your work when you need to. It also gives you a way to communicate unambiguously what you've done, + so that others can inspect or apply your process to new data.
  • +
  • Many bioinformatic tasks require large amounts of computing power and can't realistically be run on your + own machine. These tasks are best performed using remote computers or cloud computing, which can only be accessed + through a shell.
  • +
+

In this lesson you will learn how to use the command line interface to move around in your file system.

+

How to access the shell

+

On a Mac or Linux machine, you can access a shell through a program called "Terminal", which is already available +on your computer. The Terminal is a window into which we will type commands. If you're using Windows, +you'll need to download a separate program to access the shell.

+

To save time, we are going to be working on a remote server where all the necessary data and software available. +When we say a 'remote server', we are talking about a computer that is not the one you are working on right now. +You will access the Carpentries remote server where everything is prepared for the lesson. +We will learn the basics of the shell by manipulating some data files. Some of these files are very large +, and would take time to download to your computer.

+

Type the word clear into the terminal and press the Enter key.

+
+

code

+
$ clear
+
+
+

This will scroll your screen down to give you a fresh screen and will make it easier to read. +You haven't lost any of the information on your screen. If you scroll up, you can see everything that has been output to your screen +up until this point.

+
+

Hot-key combinations are shortcuts for performing common commands.

+

The hot-key combination for clearing the console is Ctrl+L. Feel free to try it and see for yourself.

+
+ +

The part of the operating system that manages files and directories +is called the file system. +It organizes our data into files, +which hold information, +and directories (also called "folders"), +which hold files or other directories.

+

Several commands are frequently used to create, inspect, rename, and delete files and directories.

+
+

code

+
$
+
+
+

The dollar sign is a prompt, which shows us that the shell is waiting for input; +your shell may use a different character as a prompt and may add information before +the prompt. When typing commands, either from these lessons or from other sources, +do not type the prompt, only the commands that follow it.

+

Let's find out where we are by running a command called pwd +(which stands for "print working directory"). +At any moment, our current working directory +is our current default directory, +i.e., +the directory that the computer assumes we want to run commands in, +unless we explicitly specify something else. +Here, +the computer's response is /home/<username>, +which is the top level directory within NeSI:

+
+

code

+
$ pwd
+
+
/home/<username>
+
+
+

Let's look at how our file system is organized. We can see what files and subdirectories are in this directory by running ls, +which stands for "listing":

+
+

code

+
$ ls
+
+
shell_data
+
+
+

ls prints the names of the files and directories in the current directory in +alphabetical order, +arranged neatly into columns. +We'll be working within the shell_data subdirectory, and creating new subdirectories, throughout this workshop.

+

The command to change locations in our file system is cd, followed by a +directory name to change our working directory. +cd stands for "change directory".

+

Let's say we want to navigate to the shell_data directory we saw above. We can +use the following command to get there:

+
+

code

+
cd shell_data
+
+

and take a look

+
$ ls
+
+
sra_metadata  untrimmed_fastq
+
+
+

We can make the ls output more comprehensible by using the flag -F, +which tells ls to add a trailing / to the names of directories:

+
+

code

+
$ ls -F
+
+
sra_metadata/  untrimmed_fastq/
+
+
+
+

what is /

+

Anything with a / after it is a directory. Things with a "*" after them are programs. If +there are no decorations, it's a file.

+
+
+

ls has lots of other options. To find out what they are, we can type:

+
$ man ls
+
+

man (short for manual) displays detailed documentation (also referred as man page or man file) +for bash commands. It is a powerful resource to explore bash commands, understand +their usage and flags. Some manual files are very long. You can scroll through the +file using your keyboard's down arrow or use the Space key to go forward one page +and the b key to go backwards one page. When you are done reading, hit q +to quit.

+
+
+

Challenge

+

Use the -l option for the ls command to display more information for each item +in the directory. What is one piece of additional information this long format +gives you that you don't see with the bare ls command?

+
+

solution

+
+
$ ls -l
+
+
total 8
+drwxr-x--- 2 training training 4096 Jul 30  2015 sra_metadata
+drwxr-xr-x 2 training training 4096 Nov 15  2017 untrimmed_fastq
+
+

The additional information given includes the name of the owner of the file, +when the file was last modified, and whether the current user has permission +to read and write to the file.

+
+

No one can possibly learn all of these arguments, that's what the manual page +is for. You can (and should) refer to the manual page or other help files +as needed.

+

Let's go into the untrimmed_fastq directory and see what is in there.

+
+

code

+
$ cd untrimmed_fastq
+$ ls -F
+
+
SRR097977.fastq  SRR098026.fastq
+
+
+

This directory contains two files with .fastq extensions. FASTQ is a format +for storing information about sequencing reads and their quality. +We will be learning more about FASTQ files in a later lesson.

+

Shortcut: Tab Completion

+

Typing out file or directory names can waste a +lot of time and it's easy to make typing mistakes. Instead we can use tab complete +as a shortcut. When you start typing out the name of a directory or file, then +hit the Tab key, the shell will try to fill in the rest of the +directory or file name.

+

Return to your home directory:

+
+

code

+
$ cd
+
+

then enter:

+
$ cd she<tab>
+
+
+

The shell will fill in the rest of the directory name for shell_data.

+

Now change directories to untrimmed_fastq in shell_data

+
+

code

+
$ cd shell_data
+$ cd untrimmed_fastq
+
+
+

Using tab complete can be very helpful. However, it will only autocomplete +a file or directory name if you've typed enough characters to provide +a unique identifier for the file or directory you are trying to access.

+

For example, if we now try to list the files which names start with SR +by using tab complete:

+
+

code

+
$ ls SR<tab>
+
+
+

The shell auto-completes your command to SRR09, because all file names in +the directory begin with this prefix. When you hit +Tab again, the shell will list the possible choices.

+
+

code

+
$ ls SRR09<tab><tab>
+
+
SRR097977.fastq  SRR098026.fastq
+
+
+

Tab completion can also fill in the names of programs, which can be useful if you +remember the beginning of a program name.

+
+

code

+
$ pw<tab><tab>
+
+
pwck      pwconv    pwd       pwdx      pwunconv
+
+
+

Displays the name of every program that starts with pw.

+
+

Summary

+

We now know how to move around our file system using the command line. +This gives us an advantage over interacting with the file system through +a GUI as it allows us to work on a remote server, carry out the same set of operations +on a large number of files quickly, and opens up many opportunities for using +bioinformatic software that is only available in command line versions.

+

In the next few episodes, we'll be expanding on these skills and seeing how +using the command line shell enables us to make our workflow more efficient and reproducible.

+
    +
  • The shell gives you the ability to work more efficiently by using keyboard commands rather than a GUI.
  • +
  • Useful commands for navigating your file system include: ls, pwd, and cd.
  • +
  • Most commands take options (flags) which begin with a -.
  • +
  • Tab completion can reduce errors from mistyping and make work more efficient in the shell.
  • +
+
+ + + + + + + + + + + + + +
+
+ + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/02-the-filesystem/index.html b/02-the-filesystem/index.html new file mode 100644 index 0000000..54cad20 --- /dev/null +++ b/02-the-filesystem/index.html @@ -0,0 +1,1000 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + 2. Navigating Files and Directories - Introduction to Shell for Bioinformatics + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + + + +
+ + +
+ +
+ + + + + + +
+
+ + + +
+
+
+ + + + + +
+
+
+ + + + + + + +
+
+ + + + + + + +

2. Navigating Files and Directories

+
+

Lesson objectives

+
    +
  • Use a single command to navigate multiple steps in your directory structure, including moving backwards (one level up).
  • +
  • Perform operations on files in directories outside your working directory.
  • +
  • Work with hidden directories and hidden files.
  • +
  • Interconvert between absolute and relative paths.
  • +
  • Employ navigational shortcuts to move around your file system.
  • +
+
+
+

questions

+
    +
  • How can I perform operations on files outside of my working directory?
  • +
  • What are some navigational shortcuts I can use to make my work more efficient?
  • +
+
+

Moving around the file system

+

We've learned how to use pwd to find our current location within our file system. +We've also learned how to use cd to change locations and ls to list the contents +of a directory. Now we're going to learn some additional commands for moving around +within our file system.

+

Use the commands we've learned so far to navigate to the shell_data/untrimmed_fastq directory, if +you're not already there.

+
+

code

+
$ cd
+$ cd ~/shell_data
+$ cd untrimmed_fastq
+
+
+
+

What if we want to move back up and out of this directory and to our top level directory? Can we type cd shell_data? Try it and see what happens.

+
$ cd shell_data
+
+
-bash: cd: shell_data: No such file or directory
+
+
+

Your computer looked for a directory or file called shell_data within the +directory you were already in. It didn't know you wanted to look at a directory level +above the one you were located in.

+
+

We have a special command to tell the computer to move us back or up one directory level.

+
$ cd ..
+
+
+

Now we can use pwd to make sure that we are in the directory we intended to navigate +to, and ls to check that the contents of the directory are correct.

+
+

code

+
$ pwd
+
+
/home/<username>//shell_data
+
+
$ ls
+
+
sra_metadata  untrimmed_fastq
+
+
+

From this output, we can see that .. did indeed take us back one level in our file system.

+
+

You can chain these together like so:

+
$ ls ../../
+
+
+

prints the contents of /home/<username>/shell_data.

+

Finding hidden directories

+
+

Let's find a hidden directory and list it's content

+

First navigate to the shell_data directory. There is a hidden directory within this directory. Explore the options for ls to +find out how to see hidden directories. List the contents of the directory and identify the name of the text file in that directory.

+

Hint: hidden files and folders in Unix start with ., for example .my_hidden_directory

+
+Solution +

First use the man command to look at the options for ls.

+
$ man ls
+
+

The -a option is short for all and says that it causes ls to "not ignore +entries starting with ." This is the option we want.

+
$ ls -a
+
+
.  ..  .hidden  sra_metadata  untrimmed_fastq
+
+

The name of the hidden directory is .hidden. We can navigate to that directory +using cd.

+
$ cd .hidden
+
+

And then list the contents of the directory using ls.

+
$ ls
+
+
youfoundit.txt
+
+

The name of the text file is youfoundit.txt.

+
+
+

In most commands the flags can be combined together in no particular order to obtain the desired results/output.

+
+

code

+
$ ls -Fa
+$ ls -laF
+
+
+

Examining the contents of other directories

+

By default, the ls commands lists the contents of the working +directory (i.e. the directory you are in). You can always find the +directory you are in using the pwd command. However, you can also +give ls the names of other directories to view. Navigate to your +home directory if you are not already there.

+
+

code

+
$ cd
+
+

Then enter the command:

+
$ ls ~/shell_data
+
+
sra_metadata  untrimmed_fastq
+
+
+

This will list the contents of the shell_data directory without +you needing to navigate there.

+

The cd command works in a similar way.

+
+

Try entering:

+
$ cd
+$ cd ~/shell_data/untrimmed_fastq
+
+

This will take you to the untrimmed_fastq directory without having to go through +the intermediate directory.

+
+
+

Navigating practice

+

Navigate to your home directory. From there, list the contents of the untrimmed_fastq +directory.

+
+Solution +
$ cd
+$ ls ~/shell_data/untrimmed_fastq/
+
+
SRR097977.fastq  SRR098026.fastq
+
+
+
+

Full vs. Relative Paths

+

The cd command takes an argument which is a directory +name. Directories can be specified using either a relative path or a +full absolute path. The directories on the computer are arranged into a +hierarchy. The full path tells you where a directory is in that +hierarchy. Navigate to the home directory, then enter the pwd +command.

+
+

code

+
$ cd
+$ pwd
+
+

You will see:

+
/home/<username>
+
+
+

This is the full name of your home directory. This tells you that you +are in a directory called training, which sits inside a directory called +home which sits inside the very top directory in the hierarchy. The +very top of the hierarchy is a directory called / which is usually +referred to as the root directory. So, to summarize: training is a +directory in home which is a directory in /. More on root and +home in the next section.

+
+

Now enter the following command:

+
$ cd /home/<username>/shell_data/.hidden
+
+

This jumps forward multiple levels to the .hidden directory. +Now go back to the home directory.

+
$ cd
+
+
+

You can also navigate to the .hidden directory using:

+
$ cd obss_2023/commandline/shell_data/.hidden
+
+

These two commands have the same effect, they both take us to the .hidden directory. +The first uses the absolute path, giving the full address from the home directory. The +second uses a relative path, giving only the address from the working directory. A full +path always starts with a /. A relative path does not.

+

A relative path is like getting directions from someone on the street. They tell you to +"go right at the stop sign, and then turn left on Main Street". That works great if +you're standing there together, but not so well if you're trying to tell someone how to +get there from another country. A full path is like GPS coordinates. It tells you exactly +where something is no matter where you are right now.

+

You can usually use either a full path or a relative path depending on what is most convenient. +If we are in the home directory, it is more convenient to enter the full path. +If we are in the working directory, it is more convenient to enter the relative path +since it involves less typing.

+

Over time, it will become easier for you to keep a mental note of the +structure of the directories that you are using and how to quickly +navigate amongst them.

+

::::::::::::::::::::::::::::::::::::::: challenge

+

Relative path resolution

+

Using the filesystem diagram below, if pwd displays /Users/thing, +what will ls ../backup display?

+
    +
  1. ../backup: No such file or directory
  2. +
  3. 2012-12-01 2013-01-08 2013-01-27
  4. +
  5. 2012-12-01/ 2013-01-08/ 2013-01-27/
  6. +
  7. original pnas_final pnas_sub
  8. +
+

File System for Challenge Questions

+

::::::::::::::: solution

+

Solution

+
    +
  1. No: there is a directory backup in /Users.
  2. +
  3. No: this is the content of Users/thing/backup, + but with .. we asked for one level further up.
  4. +
  5. No: see previous explanation. + Also, we did not specify -F to display / at the end of the directory names.
  6. +
  7. Yes: ../backup refers to /Users/backup.
  8. +
+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+ +

The root directory is the highest level directory in your file +system and contains files that are important for your computer +to perform its daily work. While you will be using the root (/) +at the beginning of your absolute paths, it is important that you +avoid working with data in these higher-level directories, as +your commands can permanently alter files that the operating +system needs to function. In many cases, trying to run commands +in root directories will require special permissions which are +not discussed here, so it's best to avoid them and work within your +home directory. Dealing with the home directory is very common. +The tilde character, ~, is a shortcut for your home directory. +In our case, the root directory is two levels above our +home directory, so cd or cd ~ will take you to +/home/<username> and cd / will take you to /. Navigate to the +shell_data directory:

+
+

code

+
$ cd
+$ cd ~/shell_data
+
+

Then enter the command:

+
$ ls ~
+
+
shell_data
+
+
+

This prints the contents of your home directory, without you needing to +type the full path.

+
+

The commands cd, and cd ~ are very useful for quickly navigating back to your home directory. We will be using the ~ character in later lessons to specify our home directory.

+
+
+

Summary

+
    +
  • The /, ~, and .. characters represent important navigational shortcuts.
  • +
  • Hidden files and directories start with . and can be viewed using ls -a.
  • +
  • Relative paths specify a location starting from the current location, while absolute paths specify a location from the root of the file system.
  • +
+
+ + + + + + + + + + + + + +
+
+ + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/03-working-with-files/index.html b/03-working-with-files/index.html new file mode 100644 index 0000000..9709a24 --- /dev/null +++ b/03-working-with-files/index.html @@ -0,0 +1,1310 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + 3. Working with Files and Directories - Introduction to Shell for Bioinformatics + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + + + +
+ + +
+ +
+ + + + + + +
+
+ + + +
+
+
+ + + + + +
+
+
+ + + + + + + +
+
+ + + + + + + +

3. Working with Files and Directories

+
+

Lesson objectives

+
    +
  • View, search within, copy, move, and rename files. Create new directories.
  • +
  • Use wildcards (*) to perform operations on multiple files.
  • +
  • Make a file read only.
  • +
  • Use the history command to view and repeat recently used commands.
  • +
+
+
+

questions

+
    +
  • How can I view and search file contents?
  • +
  • How can I create, copy and delete files and directories?
  • +
  • How can I control who has permission to modify a file?
  • +
  • How can I repeat recently used commands?
  • +
+
+

Working with Files

+

Our data set: FASTQ files

+

Now that we know how to navigate around our directory structure, let's +start working with our sequencing files. We did a sequencing experiment and +have two results files, which are stored in our untrimmed_fastq directory.

+

Wildcards

+
+

Navigate to your untrimmed_fastq directory:

+
+
$ cd ~/shell_data/untrimmed_fastq
+
+

We are interested in looking at the FASTQ files in this directory. We can list + all files with the .fastq extension using the command:

+
$ ls *.fastq
+
+
SRR097977.fastq  SRR098026.fastq
+
+

The * character is a special type of character called a wildcard, which can be used to represent any number of any type of character. +Thus, *.fastq matches every file that ends with .fastq.

+

This command:

+
+

code

+
$ ls *977.fastq
+
+
SRR097977.fastq
+
+

lists only the file that ends with 977.fastq.

+
+

This command:

+
$ ls /usr/bin/*.sh
+
+
/usr/bin/gettext.sh             /usr/bin/ibdiagm.sh   /usr/bin/mft_uninstall.sh       /usr/bin/unix-lpr.sh
+/usr/bin/gflags_completions.sh  /usr/bin/lesspipe.sh  /usr/bin/mlnx_interface_mgr.sh
+/usr/bin/gvmap.sh               /usr/bin/lprsetup.sh  /usr/bin/setup-nsssysinit.sh
+
+

Lists every file in /usr/bin that ends in the characters .sh. +Note that the output displays full paths to files, since +each result starts with /.

+
+

Exercise

+

Do each of the following tasks from your current directory using a single +ls command for each:

+
    +
  1. List all of the files in /usr/bin that start with the letter 'c'.
  2. +
  3. List all of the files in /usr/bin that contain the letter 'a'.
  4. +
  5. List all of the files in /usr/bin that end with the letter 'o'.
  6. +
+

Bonus: List all of the files in /usr/bin that contain the letter 'a' or the + letter 'c'.

+

Hint: The bonus question requires a Unix wildcard that we haven't talked about + yet. Try searching the internet for information about Unix wildcards to find + what you need to solve the bonus problem.

+
+Solution +
    +
  1. ls /usr/bin/c*
  2. +
  3. ls /usr/bin/*a*
  4. +
  5. ls /usr/bin/*o
    + Bonus: ls /usr/bin/*[ac]*
  6. +
+
+
+
+

Exercise

+

echo is a built-in shell command that writes its arguments, like a line of text to standard output. +The echo command can also be used with pattern matching characters, such as wildcard characters. +Here we will use the echo command to see how the wildcard character is interpreted by the shell.

+
$ echo *.fastq
+
+
SRR097977.fastq SRR098026.fastq
+
+

The * is expanded to include any file that ends with .fastq. We can see that the output of +echo *.fastq is the same as that of ls *.fastq.

+

What would the output look like if the wildcard could not be matched? Compare the outputs of +echo *.missing and ls *.missing.

+
+Solution +
$ echo *.missing
+
+
*.missing
+
+
$ ls *.missing
+
+
ls: cannot access '*.missing': No such file or directory
+
+
+
+

Command History

+

If you want to repeat a command that you've run recently, you can access previous +commands using the up arrow on your keyboard to go back to the most recent +command. Likewise, the down arrow takes you forward in the command history.

+

A few more useful shortcuts:

+
    +
  • Ctrl+C will cancel the command you are writing, and give you a + fresh prompt.
  • +
  • Ctrl+R will do a reverse-search through your command history. This + is very useful.
  • +
  • Ctrl+L or the clear command will clear your screen.
  • +
+
+

You can also review your recent commands with the history command, by entering:

+
$ history
+
+
+

to see a numbered list of recent commands. You can reuse one of these commands +directly by referring to the number of that command.

+
+

For example, if your history looked like this:

+
259  ls *
+260  ls /usr/bin/*.sh
+261  ls *R1*fastq
+
+
+
+

then you could repeat command #260 by entering:

+
$ !260
+
+
+

Type ! (exclamation point) and then the number of the command from your history. +You will be glad you learned this when you need to re-run very complicated commands. +For more information on advanced usage of history, read section 9.3 of +Bash manual.

+
+

Exercise

+

Find the line number in your history for the command that listed all the .sh +files in /usr/bin. Rerun that command.

+
+solution +

First type history. Then use ! followed by the line number to rerun that command.

+
+
+

Examining Files

+

We now know how to switch directories, run programs, and look at the +contents of directories, but how do we look at the contents of files?

+

One way to examine a file is to print out all of the +contents using the program cat.

+

Enter the following command from within the untrimmed_fastq directory:

+
+

code

+
$ cat SRR098026.fastq
+
+
+

This will print out all of the contents of the SRR098026.fastq to the screen.

+
+

Exercise

+
    +
  1. Print out the contents of the ~/shell_data/untrimmed_fastq/SRR097977.fastq file. What is the last line of the file?
  2. +
  3. From your home directory, and without changing directories, + use one short command to print the contents of all of the files in + the ~/shell_data/untrimmed_fastq directory.
  4. +
+
+Solution +
    +
  1. The last line of the file is C:CCC::CCCCCCCC<8?6A:C28C<608'&&&,'$.
  2. +
  3. cat ~/shell_data/untrimmed_fastq/*
  4. +
+
+
+

cat is a terrific program, but when the file is really big, it can +be annoying to use. The program, less, is useful for this +case. less opens the file as read only, and lets you navigate through it. The navigation commands +are identical to the man program.

+
+

Enter the following command:

+
$ less SRR097977.fastq
+
+
+

Some navigation commands in less:

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
keyaction
Spaceto go forward
bto go backward
gto go to the beginning
Gto go to the end
qto quit
+

less also gives you a way of searching through files. Use the +"/" key to begin a search. Enter the word you would like +to search for and press enter. The screen will jump to the next location where +that word is found.

+

Shortcut: If you hit "/" then "enter", less will repeat +the previous search. less searches from the current location and +works its way forward. Scroll up a couple lines on your terminal to verify +you are at the beginning of the file. Note, if you are at the end of the file and search +for the sequence "CAA", less will not find it. You either need to go to the +beginning of the file (by typing g) and search again using / or you +can use ? to search backwards in the same way you used / previously.

+

For instance, let's search forward for the sequence TTTTT in our file. +You can see that we go right to that sequence, what it looks like, +and where it is in the file. If you continue to type / and hit return, you will move +forward to the next instance of this sequence motif. If you instead type ? and hit +return, you will search backwards and move up the file to previous examples of this motif.

+
+

Exercise

+

What are the next three nucleotides (characters) after the first instance of the sequence quoted above?

+
+

??? success "Solution"

+

CAC

+

Remember, the man program actually uses less internally and +therefore uses the same commands, so you can search documentation +using "/" as well!

+

There's another way that we can look at files, and in this case, just +look at part of them. This can be particularly useful if we just want +to see the beginning or end of the file, or see how it's formatted.

+

The commands are head and tail and they let you look at +the beginning and end of a file, respectively.

+
+

code

+
$ head SRR098026.fastq
+
+
@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+NNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNN
++SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
+@SRR098026.2 HWUSI-EAS1599_1:2:1:0:312 length=35
+NNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN
++SRR098026.2 HWUSI-EAS1599_1:2:1:0:312 length=35
+!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
+@SRR098026.3 HWUSI-EAS1599_1:2:1:0:570 length=35
+NNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN
+
+
$ tail SRR098026.fastq
+
+
+SRR098026.247 HWUSI-EAS1599_1:2:1:2:1311 length=35
+#!##!#################!!!!!!!######
+@SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
+GNTGNGGTCATCATACGCGCCCNNNNNNNGGCATG
++SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
+B!;?!A=5922:##########!!!!!!!######
+@SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
+CNCTNTATGCGTACGGCAGTGANNNNNNNGGAGAT
++SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
+A!@B!BBB@ABAB#########!!!!!!!######
+
+
+
+

The -n option to either of these commands can be used to print the first or last n lines of a file.

+
$ head -n 1 SRR098026.fastq
+
+
@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+
+
$ tail -n 1 SRR098026.fastq
+
+
A!@B!BBB@ABAB#########!!!!!!!######
+
+
+

Details on the FASTQ format

+

Although it looks complicated (and it is), it's easy to understand the +fastq format with a little decoding. Some rules about the format +include...

+ + + + + + + + + + + + + + + + + + + + + + + + + +
LineDescription
1Always begins with '@' and then information about the read
2The actual DNA sequence
3Always begins with a '+' and sometimes the same info in line 1
4Has a string of characters which represent the quality scores; must have same number of characters as line 2
+

We can view the first complete read in one of the files in our dataset by using head to look at +the first four lines.

+
+

code

+
$ head -n 4 SRR098026.fastq
+
+
@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+NNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNN
++SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
+!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
+
+
+

All but one of the nucleotides in this read are unknown (N). This is a pretty bad read! +Line 4 shows the quality for each nucleotide in the read. We'll cover the Fastq format more in depth tomorrow in when we look at assessing read quality in the DNA variant calling workshop.

+

Creating, moving, copying, and removing

+

Now we can move around in the file structure, look at files, and search files. But what if we want to copy files or move +them around or get rid of them? Most of the time, you can do these sorts of file manipulations without the command line, +but there will be some cases (like when you're working with a remote computer like we are for this lesson) where it will be +impossible. You'll also find that you may be working with hundreds of files and want to do similar manipulations to all +of those files. In cases like this, it's much faster to do these operations at the command line.

+

Copying Files

+

When working with computational data, it's important to keep a safe copy of that data that can't be accidentally overwritten or deleted. +For this lesson, our raw data is our FASTQ files. We don't want to accidentally change the original files, so we'll make a copy of them +and change the file permissions so that we can read from, but not write to, the files.

+

First, let's make a copy of one of our FASTQ files using the cp command.

+
+

Navigate to the ~/shell_data/untrimmed_fastq directory and enter:

+
$ cp SRR098026.fastq SRR098026-copy.fastq
+$ ls -F
+
+
SRR097977.fastq  SRR098026-copy.fastq  SRR098026.fastq
+
+
+

We now have two copies of the SRR098026.fastq file, one of them named SRR098026-copy.fastq. We'll move this file to a new directory +called backup where we'll store our backup data files.

+

Creating Directories

+
+

The mkdir command is used to make a directory. Enter mkdir followed by a space, then the directory name you want to create:

+
$ mkdir backup
+
+
+

Moving / Renaming

+
+

We can now move our backup file to this directory. We can move files around using the command mv:

+
$ mv SRR098026-copy.fastq backup
+$ ls backup
+
+
SRR098026-copy.fastq
+
+
+
+

The mv command is also how you rename files. Let's rename this file to make it clear that this is a backup:

+
$ cd backup
+$ mv SRR098026-copy.fastq SRR098026-backup.fastq
+$ ls
+
+
SRR098026-backup.fastq
+
+
+

File Permissions

+

We've now made a backup copy of our file, but just because we have two copies, it doesn't make us safe. We can still accidentally delete or +overwrite both copies. To make sure we can't accidentally mess up this backup file, we're going to change the permissions on the file so +that we're only allowed to read (i.e. view) the file, not write to it (i.e. make new changes).

+
+

View the current permissions on a file using the -l (long) flag for the ls command:

+
$ ls -l
+
+
-rw-r--r-- 1 dcuser dcuser 43332 Nov 15 23:02 SRR098026-backup.fastq
+
+
+

The first part of the output for the -l flag gives you information about the file's current permissions. There are ten slots in the +permissions list. The first character in this list is related to file type, not permissions, so we'll ignore it for now. The next three +characters relate to the permissions that the file owner has, the next three relate to the permissions for group members, and the final +three characters specify what other users outside of your group can do with the file. We're going to concentrate on the three positions +that deal with your permissions (as the file owner).

+

Permissions breakdown

+

Here the three positions that relate to the file owner are rw-. The r means that you have permission to read the file, the w +indicates that you have permission to write to (i.e. make changes to) the file, and the third position is a -, indicating that you +don't have permission to carry out the ability encoded by that space (this is the space where x or executable ability is stored, we'll +talk more about this in a later lesson).

+

Our goal for now is to change permissions on this file so that you no longer have w or write permissions. We can do this using the chmod (change mode) command and subtracting (-) the write permission -w.

+
+

code

+
$ chmod -w SRR098026-backup.fastq
+$ ls -l
+
+
-r--r--r-- 1 dcuser dcuser 43332 Nov 15 23:02 SRR098026-backup.fastq
+
+
+

Removing

+

To prove to ourselves that you no longer have the ability to modify this file, try deleting it with the rm command:

+
+

code

+
$ rm SRR098026-backup.fastq
+
+
+

You'll be asked if you want to override your file permissions:

+
rm: remove write-protected regular file ‘SRR098026-backup.fastq'?
+
+

You should enter n for no. If you enter n (for no), the file will not be deleted. If you enter y, you will delete the file. This gives us an extra +measure of security, as there is one more step between us and deleting our data files.

+

Important: The rm command permanently removes the file. Be careful with this command. It doesn't +just nicely put the files in the Trash. They're really gone.

+

By default, rm will not delete directories. You can tell rm to +delete a directory using the -r (recursive) option. Let's delete the backup directory +we just made.

+
+

Enter the following command:

+
$ cd ..
+$ rm -r backup
+
+
+

This will delete not only the directory, but all files within the directory. If you have write-protected files in the directory, you will be asked whether you want to override your permission settings.

+
+

Exercise

+

Starting in the ~/shell_data/untrimmed_fastq/ directory, do the following:

+
    +
  1. Make sure that you have deleted your backup directory and all files it contains.
  2. +
  3. Create a backup of each of your FASTQ files using cp. (Note: You'll need to do this individually for each of the two FASTQ files. We haven't + learned yet how to do this + with a wildcard.)
  4. +
  5. Use a wildcard to move all of your backup files to a new backup directory.
  6. +
  7. Change the permissions on all of your backup files to be write-protected.
  8. +
+
+Solution +
    +
  1. rm -r backup
  2. +
  3. cp SRR098026.fastq SRR098026-backup.fastq and cp SRR097977.fastq SRR097977-backup.fastq
  4. +
  5. mkdir backup and mv *-backup.fastq backup
  6. +
  7. chmod -w backup/*-backup.fastq
    + It's always a good idea to check your work with ls -l backup. You should see something like:
  8. +
+
-r--r--r-- 1 dcuser dcuser 47552 Nov 15 23:06 SRR097977-backup.fastq
+-r--r--r-- 1 dcuser dcuser 43332 Nov 15 23:06 SRR098026-backup.fastq
+
+
+
+
+

keypoints

+
    +
  • You can view file contents using less, cat, head or tail.
  • +
  • The commands cp, mv, and mkdir are useful for manipulating existing files and creating new directories.
  • +
  • You can view file permissions using ls -l and change permissions using chmod.
  • +
  • The history command and the up arrow on your keyboard can be used to repeat recently used commands.
  • +
+
+ + + + + + + + + + + + + +
+
+ + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/04-redirection/index.html b/04-redirection/index.html new file mode 100644 index 0000000..eea7540 --- /dev/null +++ b/04-redirection/index.html @@ -0,0 +1,1404 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + 4. Redirection - Introduction to Shell for Bioinformatics + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + + + +
+ + +
+ +
+ + + + + + +
+
+ + + + + + + + + + + +
+
+ + + + + + + +

4. Redirection

+
+

Lesson Objectives

+
    +
  • Employ the grep command to search for information within files.
  • +
  • Print the results of a command to a file.
  • +
  • Construct command pipelines with two or more stages.
  • +
  • Use for loops to run the same command for several input files.
  • +
+
+
+

questions

+
    +
  • How can I search within files?
  • +
  • How can I combine existing commands to do new things?
  • +
+
+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Searching files

+

We discussed in a previous episode how to search within a file using less. We can also +search within files without even opening them, using grep. grep is a command-line +utility for searching plain-text files for lines matching a specific set of +characters (sometimes called a string) or a particular pattern +(which can be specified using something called regular expressions). We're not going to work with +regular expressions in this lesson, and are instead going to specify the strings +we are searching for. +Let's give it a try!

+

::::::::::::::::::::::::::::::::::::::::: callout

+

Nucleotide abbreviations

+

The four nucleotides that appear in DNA are abbreviated A, C, T and G. +Unknown nucleotides are represented with the letter N. An N appearing +in a sequencing file represents a position where the sequencing machine was not able to +confidently determine the nucleotide in that position. You can think of an N as being aNy +nucleotide at that position in the DNA sequence.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

We'll search for strings inside of our fastq files. Let's first make sure we are in the correct +directory:

+
$ cd ~/obss_2023/commandline/shell_data/untrimmed_fastq
+
+

Suppose we want to see how many reads in our file have really bad segments containing 10 consecutive unknown nucleotides (Ns).

+

::::::::::::::::::::::::::::::::::::::::: callout

+

Determining quality

+

In this lesson, we're going to be manually searching for strings of Ns within our sequence +results to illustrate some principles of file searching. It can be really useful to do this +type of searching to get a feel for the quality of your sequencing results, however, in your +research you will most likely use a bioinformatics tool that has a built-in program for +filtering out low-quality reads. You'll learn how to use one such tool in +a later lesson.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Let's search for the string NNNNNNNNNN in the SRR098026 file:

+
$ grep NNNNNNNNNN SRR098026.fastq
+
+

This command returns a lot of output to the terminal. Every single line in the SRR098026 +file that contains at least 10 consecutive Ns is printed to the terminal, regardless of how long or short the file is. +We may be interested not only in the actual sequence which contains this string, but +in the name (or identifier) of that sequence. We discussed in a previous lesson +that the identifier line immediately precedes the nucleotide sequence for each read +in a FASTQ file. We may also want to inspect the quality scores associated with +each of these reads. To get all of this information, we will return the line +immediately before each match and the two lines immediately after each match.

+

We can use the -B argument for grep to return a specific number of lines before +each match. The -A argument returns a specific number of lines after each matching line. Here we want the line before and the two lines after each +matching line, so we add -B1 -A2 to our grep command:

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq
+
+

One of the sets of lines returned by this command is:

+
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
+CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
+#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
+
+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+
    +
  1. +

    Search for the sequence GNATNACCACTTCC in the SRR098026.fastq file. + Have your search return all matching lines and the name (or identifier) for each sequence + that contains a match.

    +
  2. +
  3. +

    Search for the sequence AAGTT in both FASTQ files. + Have your search return all matching lines and the name (or identifier) for each sequence + that contains a match.

    +
  4. +
+

::::::::::::::: solution

+

Solution

+
    +
  1. grep -B1 GNATNACCACTTCC SRR098026.fastq
  2. +
+
@SRR098026.245 HWUSI-EAS1599_1:2:1:2:801 length=35
+GNATNACCACTTCCAGTGCTGANNNNNNNGGGATG
+
+
    +
  1. grep -B1 AAGTT *.fastq
  2. +
+
SRR097977.fastq-@SRR097977.11 209DTAAXX_Lenski2_1_7:8:3:247:351 length=36
+SRR097977.fastq:GATTGCTTTAATGAAAAAGTCATATAAGTTGCCATG
+--
+SRR097977.fastq-@SRR097977.67 209DTAAXX_Lenski2_1_7:8:3:544:566 length=36
+SRR097977.fastq:TTGTCCACGCTTTTCTATGTAAAGTTTATTTGCTTT
+--
+SRR097977.fastq-@SRR097977.68 209DTAAXX_Lenski2_1_7:8:3:724:110 length=36
+SRR097977.fastq:TGAAGCCTGCTTTTTTATACTAAGTTTGCATTATAA
+--
+SRR097977.fastq-@SRR097977.80 209DTAAXX_Lenski2_1_7:8:3:258:281 length=36
+SRR097977.fastq:GTGGCGCTGCTGCATAAGTTGGGTTATCAGGTCGTT
+--
+SRR097977.fastq-@SRR097977.92 209DTAAXX_Lenski2_1_7:8:3:353:318 length=36
+SRR097977.fastq:GGCAAAATGGTCCTCCAGCCAGGCCAGAAGCAAGTT
+--
+SRR097977.fastq-@SRR097977.139 209DTAAXX_Lenski2_1_7:8:3:703:655 length=36
+SRR097977.fastq:TTTATTTGTAAAGTTTTGTTGAAATAAGGGTTGTAA
+--
+SRR097977.fastq-@SRR097977.238 209DTAAXX_Lenski2_1_7:8:3:592:919 length=36
+SRR097977.fastq:TTCTTACCATCCTGAAGTTTTTTCATCTTCCCTGAT
+--
+SRR098026.fastq-@SRR098026.158 HWUSI-EAS1599_1:2:1:1:1505 length=35
+SRR098026.fastq:GNNNNNNNNCAAAGTTGATCNNNNNNNNNTGTGCG
+
+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Redirecting output

+

grep allowed us to identify sequences in our FASTQ files that match a particular pattern. +All of these sequences were printed to our terminal screen, but in order to work with these +sequences and perform other operations on them, we will need to capture that output in some +way.

+

We can do this with something called "redirection". The idea is that +we are taking what would ordinarily be printed to the terminal screen and redirecting it to another location. +In our case, we want to print this information to a file so that we can look at it later and +use other commands to analyze this data.

+

The command for redirecting output to a file is >.

+

Let's try out this command and copy all the records (including all four lines of each record) +in our FASTQ files that contain +'NNNNNNNNNN' to another file called bad_reads.txt.

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
+
+

::::::::::::::::::::::::::::::::::::::::: callout

+

File extensions

+

You might be confused about why we're naming our output file with a .txt extension. After all, +it will be holding FASTQ formatted data that we're extracting from our FASTQ files. Won't it +also be a FASTQ file? The answer is, yes - it will be a FASTQ file and it would make sense to +name it with a .fastq extension. However, using a .fastq extension will lead us to problems +when we move to using wildcards later in this episode. We'll point out where this becomes +important. For now, it's good that you're thinking about file extensions!

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

The prompt should sit there a little bit, and then it should look like nothing +happened. But type ls. You should see a new file called bad_reads.txt.

+

We can check the number of lines in our new file using a command called wc. +wc stands for word count. This command counts the number of words, lines, and characters +in a file. The FASTQ file may change over time, so given the potential for updates, +make sure your file matches your instructor's output.

+

As of Sept. 2020, wc gives the following output:

+
$ wc bad_reads.txt
+
+
  802    1338   24012 bad_reads.txt
+
+

This will tell us the number of lines, words and characters in the file. If we +want only the number of lines, we can use the -l flag for lines.

+
$ wc -l bad_reads.txt
+
+
802 bad_reads.txt
+
+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

How many sequences are there in SRR098026.fastq? Remember that every sequence is formed by four lines.

+

::::::::::::::: solution

+

Solution

+
$ wc -l SRR098026.fastq
+
+
996
+
+

Now you can divide this number by four to get the number of sequences in your fastq file.

+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

How many sequences in SRR098026.fastq contain at least 3 consecutive Ns?

+

::::::::::::::: solution

+

Solution

+
$ grep NNN SRR098026.fastq > bad_reads.txt
+$ wc -l bad_reads.txt
+
+
249
+
+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

We might want to search multiple FASTQ files for sequences that match our search pattern. +However, we need to be careful, because each time we use the > command to redirect output +to a file, the new output will replace the output that was already present in the file. +This is called "overwriting" and, just like you don't want to overwrite your video recording +of your kid's first birthday party, you also want to avoid overwriting your data files.

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
+$ wc -l bad_reads.txt
+
+
802 bad_reads.txt
+
+
$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq > bad_reads.txt
+$ wc -l bad_reads.txt
+
+
0 bad_reads.txt
+
+

Here, the output of our second call to wc shows that we no longer have any lines in our bad_reads.txt file. This is +because the second file we searched (SRR097977.fastq) does not contain any lines that match our +search sequence. So our file was overwritten and is now empty.

+

We can avoid overwriting our files by using the command >>. >> is known as the "append redirect" and will +append new output to the end of a file, rather than overwriting it.

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
+$ wc -l bad_reads.txt
+
+
802 bad_reads.txt
+
+
$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq >> bad_reads.txt
+$ wc -l bad_reads.txt
+
+
802 bad_reads.txt
+
+

The output of our second call to wc shows that we have not overwritten our original data.

+

We can also do this with a single line of code by using a wildcard:

+
$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.txt
+$ wc -l bad_reads.txt
+
+
802 bad_reads.txt
+
+

::::::::::::::::::::::::::::::::::::::::: callout

+

File extensions - part 2

+

This is where we would have trouble if we were naming our output file with a .fastq extension. +If we already had a file called bad_reads.fastq (from our previous grep practice) +and then ran the command above using a .fastq extension instead of a .txt extension, grep +would give us a warning.

+
grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.fastq
+
+
grep: input file ‘bad_reads.fastq' is also the output
+
+

grep is letting you know that the output file bad_reads.fastq is also included in your +grep call because it matches the *.fastq pattern. Be careful with this as it can lead to +some unintended results.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Since we might have multiple different criteria we want to search for, +creating a new output file each time has the potential to clutter up our workspace. We also +thus far haven't been interested in the actual contents of those files, only in the number of +reads that we've found. We created the files to store the reads and then counted the lines in +the file to see how many reads matched our criteria. There's a way to do this, however, that +doesn't require us to create these intermediate files - the pipe command (|).

+

This is probably not a key on +your keyboard you use very much, so let's all take a minute to find that key. +In the UK and US keyboard layouts, and several others, +the | character can be found using the key combination Shift+\. +This may be different for other language-specific layouts.

+

What | does is take the output that is scrolling by on the terminal and uses that output as input to another command. +When our output was scrolling by, we might have wished we could slow it down and +look at it, like we can with less. Well it turns out that we can! We can redirect our output +from our grep call through the less command.

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | less
+
+

We can now see the output from our grep call within the less interface. We can use the up and down arrows +to scroll through the output and use q to exit less.

+

If we don't want to create a file before counting lines of output from our grep search, we could directly pipe +the output of the grep search to the command wc -l. This can be helpful for investigating your output if you are not sure +you would like to save it to a file.

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | wc -l
+
+

Because we asked grep for all four lines of each FASTQ record, we need to divide the output by +four to get the number of sequences that match our search pattern. Since 802 / 4 = 200.5 and we +are expecting an integer number of records, there is something added or missing in bad_reads.txt. +If we explore bad_reads.txt using less, we might be able to notice what is causing the uneven +number of lines. Luckily, this issue happens by the end of the file so we can also spot it with tail.

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
+$ tail bad_reads.txt
+
+
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
+ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
++SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
+#!!!!!!!!!##########!!!!!!!!!!##!#!
+--
+--
+@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
+CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
+#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
+
+

The fifth and six lines in the output display "--" which is the default action for grep to separate groups of +lines matching the pattern, and indicate groups of lines which did not match the pattern so are not displayed. +To fix this issue, we can redirect the output of grep to a second instance of grep as follows.

+
$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | grep -v '^--' > bad_reads.fastq
+$ tail bad_reads.fastq
+
+
+SRR098026.132 HWUSI-EAS1599_1:2:1:0:320 length=35
+#!!!!!!!!!##########!!!!!!!!!!##!#!
+@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
+ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
++SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
+#!!!!!!!!!##########!!!!!!!!!!##!#!
+@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
+CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
++SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
+#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
+
+

The -v option in the second grep search stands for --invert-match meaning grep will now only display the +lines which do not match the searched pattern, in this case '^--'. The caret (^) is an anchoring +character matching the beginning of the line, and the pattern has to be enclose by single quotes so grep does +not interpret the pattern as an extended option (starting with --).

+

::::::::::::::::::::::::::::::::::::::::: callout

+

Custom grep control

+

Use man grep to read more about other options to customize the output of grep including extended options, +anchoring characters, and much more.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Redirecting output is often not intuitive, and can take some time to get used to. Once you're +comfortable with redirection, however, you'll be able to combine any number of commands to +do all sorts of exciting things with your data!

+

None of the command line programs we've been learning +do anything all that impressive on their own, but when you start chaining +them together, you can do some really powerful things very +efficiently.

+

::::::::::::::::::::::::::::::::::::::::: callout

+

File manipulation and more practices with pipes

+

To practice a bit more with the tools we've added to our tool kit so far and learn a few extra ones you can follow this extra lesson which uses the SRA metadata file.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Writing for loops

+

Loops are key to productivity improvements through automation as they allow us to execute commands repeatedly. +Similar to wildcards and tab completion, using loops also reduces the amount of typing (and typing mistakes). +Loops are helpful when performing operations on groups of sequencing files, such as unzipping or trimming multiple +files. We will use loops for these purposes in subsequent analyses, but will cover the basics of them for now.

+

When the shell sees the keyword for, it knows to repeat a command (or group of commands) once for each item in a list. +Each time the loop runs (called an iteration), an item in the list is assigned in sequence to the variable, and +the commands inside the loop are executed, before moving on to the next item in the list. Inside the loop, we call for +the variable's value by putting $ in front of it. The $ tells the shell interpreter to treat the variable +as a variable name and substitute its value in its place, rather than treat it as text or an external command. In shell programming, this is usually called "expanding" the variable.

+

Sometimes, we want to expand a variable without any whitespace to its right. +Suppose we have a variable named foo that contains the text abc, and would +like to expand foo to create the text abcEFG.

+
$ foo=abc
+$ echo foo is $foo
+foo is abc
+$ echo foo is $fooEFG      # doesn't work
+foo is
+
+

The interpreter is trying to expand a variable named fooEFG, which (probably) +doesn't exist. We can avoid this problem by enclosing the variable name in +braces ({ and }, also called "curly brackets"). bash treats the # +character as a comment character. Any text on a line after a # is ignored by +bash when evaluating the text as code.

+
$ foo=abc
+$ echo foo is $foo
+foo is abc
+$ echo foo is ${foo}EFG      # now it works!
+foo is abcEFG
+
+

Let's write a for loop to show us the first two lines of the fastq files we downloaded earlier. You will notice the shell prompt changes from $ to > and back again as we were typing in our loop. The second prompt, >, is different to remind us that we haven't finished typing a complete command yet. A semicolon, ;, can be used to separate two commands written on a single line.

+
$ cd ../untrimmed_fastq/
+
+
$ for filename in *.fastq
+> do
+> head -n 2 ${filename}
+> done
+
+

The for loop begins with the formula for <variable> in <group to iterate over>. In this case, the word filename is designated +as the variable to be used over each iteration. In our case SRR097977.fastq and SRR098026.fastq will be substituted for filename +because they fit the pattern of ending with .fastq in the directory we've specified. The next line of the for loop is do. The next line is +the code that we want to execute. We are telling the loop to print the first two lines of each variable we iterate over. Finally, the +word done ends the loop.

+

After executing the loop, you should see the first two lines of both fastq files printed to the terminal. Let's create a loop that +will save this information to a file.

+
$ for filename in *.fastq
+> do
+> head -n 2 ${filename} >> seq_info.txt
+> done
+
+

When writing a loop, you will not be able to return to previous lines once you have pressed Enter. Remember that we can cancel the current command using

+
    +
  • Ctrl+C
  • +
+

If you notice a mistake that is going to prevent your loop for executing correctly.

+

Note that we are using >> to append the text to our seq_info.txt file. If we used >, the seq_info.txt file would be rewritten +every time the loop iterates, so it would only have text from the last variable used. Instead, >> adds to the end of the file.

+

Using Basename in for loops

+

Basename is a function in UNIX that is helpful for removing a uniform part of a name from a list of files. In this case, we will use basename to remove the .fastq extension from the files that we've been working with.

+
$ basename SRR097977.fastq .fastq
+
+

We see that this returns just the SRR accession, and no longer has the .fastq file extension on it.

+
SRR097977
+
+

If we try the same thing but use .fasta as the file extension instead, nothing happens. This is because basename only works when it exactly matches a string in the file.

+
$ basename SRR097977.fastq .fasta
+
+
SRR097977.fastq
+
+

Basename is really powerful when used in a for loop. It allows to access just the file prefix, which you can use to name things. Let's try this.

+

Inside our for loop, we create a new name variable. We call the basename function inside the parenthesis, then give our variable name from the for loop, in this case ${filename}, and finally state that .fastq should be removed from the file name. It's important to note that we're not changing the actual files, we're creating a new variable called name. The line > echo $name will print to the terminal the variable name each time the for loop runs. Because we are iterating over two files, we expect to see two lines of output.

+
$ for filename in *.fastq
+> do
+> name=$(basename ${filename} .fastq)
+> echo ${name}
+> done
+
+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

Print the file prefix of all of the .txt files in our current directory.

+

::::::::::::::: solution

+

Solution

+
$ for filename in *.txt
+> do
+> name=$(basename ${filename} .txt)
+> echo ${name}
+> done
+
+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

One way this is really useful is to move files. Let's rename all of our .txt files using mv so that they have the years on them, which will document when we created them.

+
$ for filename in *.txt
+> do
+> name=$(basename ${filename} .txt)
+> mv ${filename}  ${name}_2019.txt
+> done
+
+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

Remove _2019 from all of the .txt files.

+

::::::::::::::: solution

+

Solution

+
$ for filename in *_2019.txt
+> do
+> name=$(basename ${filename} _2019.txt)
+> mv ${filename} ${name}.txt
+> done
+
+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

:::::::::::::::::::::::::::::::::::::::: keypoints

+
    +
  • grep is a powerful search tool with many options for customization.
  • +
  • >, >>, and | are different ways of redirecting output.
  • +
  • command > file redirects a command's output to a file.
  • +
  • command >> file redirects a command's output to a file without overwriting the existing contents of the file.
  • +
  • command_1 | command_2 redirects the output of the first command as input to the second command.
  • +
  • for loops are used for iteration.
  • +
  • basename gets rid of repetitive parts of names.
  • +
+

::::::::::::::::::::::::::::::::::::::::::::::::::

+ + + + + + + + + + + + + +
+
+ + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/05-writing-scripts/index.html b/05-writing-scripts/index.html new file mode 100644 index 0000000..da0870e --- /dev/null +++ b/05-writing-scripts/index.html @@ -0,0 +1,1302 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + 5. Writing Scripts and Working with Data - Introduction to Shell for Bioinformatics + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + + + +
+ + +
+ +
+ + + + + + +
+
+ + + +
+
+
+ + + + + +
+
+
+ + + + + + + +
+
+ + + + + + + +

5. Writing Scripts and Working with Data

+
+

Lesson objectives

+
    +
  • Use the nano text editor to modify text files.
  • +
  • Write a basic shell script.
  • +
  • Use the bash command to execute a shell script.
  • +
  • Use chmod to make a script an executable program.
  • +
+
+
+

questions

+
    +
  • How can we automate a commonly used set of commands?
  • +
+
+ + +

Writing files

+

We've been able to do a lot of work with files that already exist, but what if we want to write our own files? We're not going to type in a FASTA file, but we'll see as we go through other tutorials, there are a lot of reasons we'll want to write a file, or edit an existing file.

+

To add text to files, we're going to use a text editor called Nano. We're going to create a file to take notes about what we've been doing with the data files in ~/obss_2023/commandline/shell_data/untrimmed_fastq.

+

This is good practice when working in bioinformatics. We can create a file called README.txt that describes the data files in the directory or documents how the files in that directory were generated. As the name suggests, it's a file that we or others should read to understand the information in that directory.

+

Let's change our working directory to ~/obss_2023/commandline/shell_data/untrimmed_fastq using cd, +then run nano to create a file called README.txt:

+
$ cd ~/obss_2023/commandline/shell_data/untrimmed_fastq
+$ nano README.txt
+
+

You should see something like this:

+

nano201711.png

+

The text at the bottom of the screen shows the keyboard shortcuts for performing various tasks in nano. We will talk more about how to interpret this information soon.

+

::::::::::::::::::::::::::::::::::::::::: callout

+

Which Editor?

+

When we say, "nano is a text editor," we really do mean "text": nano can +only work with plain character data, not tables, images, or any other +human-friendly media. We use nano in examples because it is one of the +least complex text editors. However, because of this trait, nano may +not be powerful enough or flexible enough for the work you need to do +after this workshop. On Unix systems (such as Linux and Mac OS X), +many programmers use Emacs or +Vim (both of which require more time to learn), +or a graphical editor such as +Gedit. On Windows, you may wish to +use Notepad++. Windows also has a built-in +editor called notepad that can be run from the command line in the same +way as nano for the purposes of this lesson.

+

No matter what editor you use, you will need to know the default location where it searches +for files and where files are saved. If you start an editor from the shell, it will (probably) +use your current working directory as its default location. If you use +your computer's start menu, the editor may want to save files in your desktop or +documents directory instead. You can change this by navigating to +another directory the first time you "Save As..."

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Let's type in a few lines of text. Describe what the files in this +directory are or what you've been doing with them. +Once we're happy with our text, we can press Ctrl-O (press the Ctrl or Control key and, while +holding it down, press the O key) to write our data to disk. You'll be asked what file we want to save this to: +press Return to accept the suggested default of README.txt.

+

Once our file is saved, we can use Ctrl-X to quit the nano editor and +return to the shell.

+

::::::::::::::::::::::::::::::::::::::::: callout

+

Control, Ctrl, or ^ Key

+

The Control key is also called the "Ctrl" key. There are various ways +in which using the Control key may be described. For example, you may +see an instruction to press the Ctrl key and, while holding it down, +press the X key, described as any of:

+
    +
  • Control-X
  • +
  • Control+X
  • +
  • Ctrl-X
  • +
  • Ctrl+X
  • +
  • ^X
  • +
  • C-x
  • +
+

In nano, along the bottom of the screen you'll see ^G Get Help ^O WriteOut. +This means that you can use Ctrl-G to get help and Ctrl-O to save your +file.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Now you've written a file. You can take a look at it with less or cat, or open it up again and edit it with nano.

+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

Open README.txt and add the date to the top of the file and save the file.

+

::::::::::::::: solution

+

Solution

+

Use nano README.txt to open the file.
+Add today's date and then use Ctrl-X followed by y and Enter to save.

+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Writing scripts

+

A really powerful thing about the command line is that you can write scripts. Scripts let you save commands to run them and also lets you put multiple commands together. Though writing scripts may require an additional time investment initially, this can save you time as you run them repeatedly. Scripts can also address the challenge of reproducibility: if you need to repeat an analysis, you retain a record of your command history within the script.

+

One thing we will commonly want to do with sequencing results is pull out bad reads and write them to a file to see if we can figure out what's going on with them. We're going to look for reads with long sequences of N's like we did before, but now we're going to write a script, so we can run it each time we get new sequences, rather than type the code in by hand each time.

+

We're going to create a new file to put this command in. We'll call it bad-reads-script.sh. The sh isn't required, but using that extension tells us that it's a shell script.

+
$ nano bad-reads-script.sh
+
+

Bad reads have a lot of N's, so we're going to look for NNNNNNNNNN with grep. We want the whole FASTQ record, so we're also going to get the one line above the sequence and the two lines below. We also want to look in all the files that end with .fastq, so we're going to use the * wildcard.

+
grep -B1 -A2 -h NNNNNNNNNN *.fastq | grep -v '^--' > scripted_bad_reads.txt
+
+

::::::::::::::::::::::::::::::::::::::::: callout

+

Custom grep control

+

We introduced the -v option in the previous episode, now we +are using -h to "Suppress the prefixing of file names on output" according to the documentation shown by man grep.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Type your grep command into the file and save it as before. Be careful that you did not add the $ at the beginning of the line.

+

Now comes the neat part. We can run this script. Type:

+
$ bash bad-reads-script.sh
+
+

It will look like nothing happened, but now if you look at scripted_bad_reads.txt, you can see that there are now reads in the file.

+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

We want the script to tell us when it's done.

+
    +
  1. Open bad-reads-script.sh and add the line echo "Script finished!" after the grep command and save the file.
  2. +
  3. Run the updated script.
  4. +
+

::::::::::::::: solution

+

Solution

+
$ bash bad-reads-script.sh
+Script finished!
+
+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Making the script into a program

+

We had to type bash because we needed to tell the computer what program to use to run this script. Instead, we can turn this script into its own program. We need to tell the computer that this script is a program by making the script file executable. We can do this by changing the file permissions. We talked about permissions in an earlier episode.

+

First, let's look at the current permissions.

+
$ ls -l bad-reads-script.sh
+
+
-rw-rw-r-- 1 dcuser dcuser 0 Oct 25 21:46 bad-reads-script.sh
+
+

We see that it says -rw-r--r--. This shows that the file can be read by any user and written to by the file owner (you). We want to change these permissions so that the file can be executed as a program. We use the command chmod like we did earlier when we removed write permissions. Here we are adding (+) executable permissions (+x).

+
$ chmod +x bad-reads-script.sh
+
+

Now let's look at the permissions again.

+
$ ls -l bad-reads-script.sh
+
+
-rwxrwxr-x 1 dcuser dcuser 0 Oct 25 21:46 bad-reads-script.sh
+
+

Now we see that it says -rwxr-xr-x. The x's that are there now tell us we can run it as a program. So, let's try it! We'll need to put ./ at the beginning so the computer knows to look here in this directory for the program.

+
$ ./bad-reads-script.sh
+
+

The script should run the same way as before, but now we've created our very own computer program!

+

You will learn more about writing scripts in a later lesson.

+

Moving and Downloading Data

+

So far, we've worked with data that is pre-loaded on the instance in the cloud. Usually, however, +most analyses begin with moving data onto the instance. Below we'll show you some commands to +download data onto your instance, or to move data between your computer and the cloud.

+

Getting data from the cloud

+

There are two programs that will download data from a remote server to your local +(or remote) machine: wget and curl. They were designed to do slightly different +tasks by default, so you'll need to give the programs somewhat different options to get +the same behaviour, but they are mostly interchangeable.

+
    +
  • +

    wget is short for "world wide web get", and it's basic function is to download + web pages or data at a web address.

    +
  • +
  • +

    cURL is a pun, it is supposed to be read as "see URL", so its basic function is + to display webpages or data at a web address.

    +
  • +
+

Which one you need to use mostly depends on your operating system, as most computers will +only have one or the other installed by default.

+

Let's say you want to download some data from Ensembl. We're going to download a very small +tab-delimited file that just tells us what data is available on the Ensembl bacteria server. +Before we can start our download, we need to know whether we're using curl or wget.

+

To see which program you have, type:

+
$ which curl
+$ which wget
+
+

which is a BASH program that looks through everything you have +installed, and tells you what folder it is installed to. If it can't +find the program you asked for, it returns nothing, i.e. gives you no +results.

+

On Mac OSX, you'll likely get the following output:

+
$ which curl
+
+
/usr/bin/curl
+
+
$ which wget
+
+
$
+
+

This output means that you have curl installed, but not wget.

+

Once you know whether you have curl or wget, use one of the +following commands to download the file:

+
$ cd
+$ wget ftp://ftp.ensemblgenomes.org/pub/release-37/bacteria/species_EnsemblBacteria.txt
+
+

or

+
$ cd
+$ curl -O ftp://ftp.ensemblgenomes.org/pub/release-37/bacteria/species_EnsemblBacteria.txt
+
+

Since we wanted to download the file rather than just view it, we used wget without +any modifiers. With curl however, we had to use the -O flag, which simultaneously tells curl to +download the page instead of showing it to us and specifies that it should save the +file using the same name it had on the server: species_EnsemblBacteria.txt

+

It's important to note that both curl and wget download to the computer that the +command line belongs to. So, if you are logged into AWS on the command line and execute +the curl command above in the AWS terminal, the file will be downloaded to your AWS +machine, not your local one.

+

Moving files between your laptop and NeSI with Jupyterhub

+

With Jupyterhub on NeSI, one of the easiest way to move small-medium sized files is to use the upload option on the file explorer panel

+

+

And to download a file, you can right click on it in the explorer panel and select "Download"

+

+

::::::::::::::::::::::::::::::::::::::::: callout

+

Original instructions for downloading data from AWS

+

Moving files between your laptop and your instance - AWS

+

What if the data you need is on your local computer, but you need to get it into the +cloud? There are also several ways to do this, but it's always easier +to start the transfer locally. This means if you're typing into a terminal, the terminal +should not be logged into your instance, it should be showing your local computer. If you're +using a transfer program, it needs to be installed on your local machine, not your instance.

+

Transferring Data Between your Local Machine and the Cloud

+

If you're using Windows with PuTTY instead of Git Bash, please select the alternative option here: +

+
+

Uploading Data to your Virtual Machine with scp

+

scp stands for 'secure copy protocol', and is a widely used UNIX tool for moving files +between computers. The simplest way to use scp is to run it in your local terminal, +and use it to copy a single file:

+
scp <file I want to move> <where I want to move it>
+
+

Note that you are always running scp locally, but that doesn't mean that +you can only move files from your local computer. In order to move a file from your local computer to an AWS instance, the command would look like this:

+
$ scp <local file> <AWS instance>
+
+

To move it back to your local computer, you re-order the to and from fields:

+
$ scp <AWS instance> <local file>
+
+

Uploading Data to your Virtual Machine with scp

+

Open the terminal and use the scp command to upload a file (e.g. local_file.txt) to the dcuser home directory:

+
$  scp local_file.txt dcuser@ip.address:/home/dcuser/
+
+

Downloading Data from your Virtual Machine with scp

+

Let's download a text file from our remote machine. You should have a file that contains bad reads called ~/shell_data/scripted_bad_reads.txt.

+

Tip: If you are looking for another (or any really) text file in your home directory to use instead, try:

+
$ find ~ -name *.txt
+
+

Download the bad reads file in ~/shell_data/scripted_bad_reads.txt to your home ~/Download directory using the following command (make sure you substitute dcuser@ip.address with your remote login credentials):

+
$ scp dcuser@ip.address:/home/dcuser/shell_data/untrimmed_fastq/scripted_bad_reads.txt ~/Downloads
+
+

Remember that in both instances, the command is run from your local machine, we've just flipped the order of the to and from parts of the command.

+
+
+

Uploading Data to your Virtual Machine with PSCP

+

If you're using a Windows PC without Git Bash, we recommend you use the PSCP program. +This program is from the same suite of tools as the PuTTY program we have been using to connect.

+
    +
  1. If you haven't done so, download pscp from http://the.earth.li/~sgtatham/putty/latest/x86/pscp.exe
  2. +
  3. Make sure the PSCP program is somewhere you know on your computer. In this case, + your Downloads folder is appropriate.
  4. +
  5. Open the windows PowerShell; + go to your start menu/search enter the term 'cmd'; you will be able to start the shell + (the shell should start from C:\Users\your-pc-username>).
  6. +
  7. Change to the Downloads directory:
  8. +
+
> cd Downloads
+
+
    +
  1. Locate a file on your computer that you wish to upload (be sure you know the path). Then upload it to your remote machine (you will need to know your AMI instance address (which starts with ec2), and login credentials). You will be prompted to enter a password, and then your upload will begin. (make sure you substitute 'your-pc-username' for your actual pc username and 'ec2-54-88-126-85.compute-1.amazonaws.com' with your AMI instance address)
  2. +
+
C:\User\your-pc-username\Downloads> pscp.exe local_file.txt dcuser@ec2-54-88-126-85.compute-1.amazonaws.com:/home/dcuser/
+
+

Downloading Data from your Virtual Machine with PSCP

+
    +
  1. Follow the instructions in the Upload section to download (if needed) and access the PSCP program (steps 1-3)
  2. +
  3. Download the text file to your current working directory (represented by a .) using the following command (make sure you substitute 'your-pc-username' for your actual pc username and 'ec2-54-88-126-85.compute-1.amazonaws.com' with your AMI instance address)
  4. +
+
C:\User\your-pc-username\Downloads> pscp.exe dcuser@ec2-54-88-126-85.compute-1.amazonaws.com:/home/dcuser/shell_data/untrimmed_fastq/scripted_bad_reads.txt .
+
+C:\User\your-pc-username\Downloads
+
+
+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

:::::::::::::::::::::::::::::::::::::::: keypoints

+
    +
  • Scripts are a collection of commands executed together.
  • +
  • Transferring information to and from virtual and local computers.
  • +
+

::::::::::::::::::::::::::::::::::::::::::::::::::

+ + + + + + + + + + + + + +
+
+ + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/06-organization/index.html b/06-organization/index.html new file mode 100644 index 0000000..bb05321 --- /dev/null +++ b/06-organization/index.html @@ -0,0 +1,1028 @@ + + + + + + + + + + + + + + + + + + + + + + + + + 6. Project Organization - Introduction to Shell for Bioinformatics + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + Skip to content + + +
+
+ +
+ + + + + + +
+ + +
+ +
+ + + + + + +
+
+ + + +
+
+
+ + + + + +
+
+
+ + + +
+
+
+ + + +
+
+
+ + + +
+
+ + + + + + + +

6. Project Organization

+
+

Lesson objectives

+
    +
  • Create a file system for a bioinformatics project.
  • +
  • Explain what types of files should go in your docs, data, and results directories.
  • +
  • Use the history command and a text editor like nano to document your work on your project.
  • +
+
+
+

questions

+
    +
  • How can I organize my file system for a new bioinformatics project?
  • +
  • How can I document my work?
  • +
+
+

Getting your project started

+

Project organization is one of the most important parts of a sequencing project, and yet is often overlooked amidst the +excitement of getting a first look at new data. Of course, while it's best to get yourself organized before you even begin your analyses, +it's never too late to start, either.

+

You should approach your sequencing project similarly to how you do a biological experiment and this ideally begins with experimental design. We're going to assume that you've already designed a beautiful +sequencing experiment to address your biological question, collected appropriate samples, and that you have +enough statistical power to answer the questions you're interested in asking. These +steps are all incredibly important, but beyond the scope of our course. +For all of those steps (collecting specimens, extracting DNA, prepping your samples) +you've likely kept a lab notebook that details how and why you did each step. However, the process of documentation doesn't stop at +the sequencer!

+

Genomics projects can quickly accumulate hundreds of files across +tens of folders. Every computational analysis you perform over the course of your project is going to create +many files, which can especially become a problem when you'll inevitably want to run some of those +analyses again. For instance, you might have made significant headway into your project, but then have to remember the PCR conditions +you used to create your sequencing library months prior.

+

Other questions might arise along the way:

+
    +
  • What were your best alignment results?
  • +
  • Which folder were they in: Analysis1, AnalysisRedone, or AnalysisRedone2?
  • +
  • Which quality cutoff did you use?
  • +
  • What version of a given program did you implement your analysis in?
  • +
+

Good documentation is key to avoiding this issue, and luckily enough, +recording your computational experiments is even easier than recording lab data. Copy/Paste will become +your best friend, sensible file names will make your analysis understandable by you and your collaborators, and +writing the methods section for your next paper will be easy! Remember that in any given project of yours, it's worthwhile to consider +a future version of yourself as an entirely separate collaborator. The better your documenation is, the more this 'collaborator' will +feel indebted to you!

+

With this in mind, let's have a look at the best practices for +documenting your genomics project. Your future self will thank you.

+

In this exercise we will setup a file system for the project we will be working on during this workshop.

+

We will start by creating a directory that we can use for the rest of the workshop. First navigate to your home directory. Then confirm that you are in the correct directory using the pwd command.

+
$ cd
+$ pwd
+
+

You should see the output:

+
/home/dcuser  
+
+

::::::::::::::::::::::::::::::::::::::::: callout

+

Tip

+

If you aren't in your home directory, the easiest way to get there is to enter the command cd, which +always returns you to home.

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

Use the mkdir command to make the following directories:

+
    +
  • dc_workshop
  • +
  • dc_workshop/docs
  • +
  • dc_workshop/data
  • +
  • dc_workshop/results
  • +
+

::::::::::::::: solution

+

Solution

+
$ mkdir dc_workshop
+$ mkdir dc_workshop/docs
+$ mkdir dc_workshop/data
+$ mkdir dc_workshop/results
+
+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Use ls -R to verify that you have created these directories. The -R option for ls stands for recursive. This option causes +ls to return the contents of each subdirectory within the directory +iteratively.

+
$ ls -R dc_workshop
+
+

You should see the following output:

+
dc_workshop/:
+data  docs  results
+
+dc_workshop/data:
+
+dc_workshop/docs:
+
+dc_workshop/results: 
+
+

Organizing your files

+

Before beginning any analysis, it's important to save a copy of your +raw data. The raw data should never be changed. Regardless of how +sure you are that you want to carry out a particular data cleaning +step, there's always the chance that you'll change your mind later +or that there will be an error in carrying out the data cleaning and +you'll need to go back a step in the process. Having a raw copy of +your data that you never modify guarantees that you will always be +able to start over if something goes wrong with your analysis. When +starting any analysis, you can make a copy of your raw data file and +do your manipulations on that file, rather than the raw version. We +learned in a previous episode how to prevent overwriting our raw data +files by setting restrictive file permissions.

+

You can store any results that are generated from your analysis in +the results folder. This guarantees that you won't confuse results +file and data files in six months or two years when you are looking +back through your files in preparation for publishing your study.

+

The docs folder is the place to store any written analysis of your +results, notes about how your analyses were carried out, and +documents related to your eventual publication.

+

Documenting your activity on the project

+

When carrying out wet-lab analyses, most scientists work from a +written protocol and keep a hard copy of written notes in their lab +notebook, including any things they did differently from the +written protocol. This detailed +record-keeping process is just as important when doing computational +analyses. Luckily, it's even easier to record the steps you've +carried out computational than it is when working at the bench.

+

The history command is a convenient way to document all the +commands you have used while analyzing and manipulating your project +files. Let's document the work we have done on our project so far.

+

View the commands that you have used so far during this session using history:

+
$ history
+
+

The history likely contains many more commands than you have used for the current project. Let's view the last +several commands that focus on just what we need for this project.

+

View the last n lines of your history (where n = approximately the last few lines you think relevant). For our example, we will use the last 7:

+
$ history | tail -n 7
+
+

::::::::::::::::::::::::::::::::::::::: challenge

+

Exercise

+

Using your knowledge of the shell, use the append redirect >> to create a file called +dc_workshop_log_XXXX_XX_XX.sh (Use the four-digit year, two-digit month, and two digit day, e.g. +dc_workshop_log_2017_10_27.sh)

+

::::::::::::::: solution

+

Solution

+
$ history | tail -n 7 >> dc_workshop_log_2017_10_27.sh
+
+

Note we used the last 7 lines as an example, the number of lines may vary.

+

:::::::::::::::::::::::::

+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

You may have noticed that your history contains the history command itself. To remove this redundancy +from our log, let's use the nano text editor to fix the file:

+
$ nano dc_workshop_log_2017_10_27.sh
+
+

(Remember to replace the 2017_10_27 with your workshop date.)

+

From the nano screen, you can use your cursor to navigate, type, and delete any redundant lines.

+

::::::::::::::::::::::::::::::::::::::::: callout

+ +

Although nano is useful, it can be frustrating to edit documents, as you +can't use your mouse to navigate to the part of the document you would like to edit. +Here are some useful keyboard shortcuts for moving around within a text document in +nano. You can find more information by typing Ctrl-G within nano.

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
keyaction
Ctrl-Space OR Ctrl-to move forward one word
Alt-Space OR Esc-Space OR Ctrl-to move back one word
Ctrl-Ato move to the beginning of the current line
Ctrl-Eto move to the end of the current line
Ctrl-Wto search
+

::::::::::::::::::::::::::::::::::::::::::::::::::

+

Add a date line and comment to the line where you have created the directory. Recall that any +text on a line after a # is ignored by bash when evaluating the text as code. For example:

+
# 2017_10_27   
+# Created sample directories for the Data Carpentry workshop  
+
+

Next, remove any lines of the history that are not relevant by navigating to those lines and using your +delete key. Save your file and close nano.

+

Your file should look something like this:

+
# 2017_10_27
+# Created sample directories for the Data Carpentry workshop
+
+mkdir dc_workshop
+mkdir dc_workshop/docs
+mkdir dc_workshop/data
+mkdir dc_workshop/results
+
+

If you keep this file up to date, you can use it to re-do your work on your project if something happens to your results files. To demonstrate how this works, first delete +your dc_workshop directory and all of its subdirectories. Look at your directory +contents to verify the directory is gone.

+
$ rm -r dc_workshop
+$ ls
+
+
shell_data  dc_workshop_log_2017_10_27.sh
+
+

Then run your workshop log file as a bash script. You should see the dc_workshop +directory and all of its subdirectories reappear.

+
$ bash dc_workshop_log_2017_10_27.sh
+$ ls
+
+
shell_data  dc_workshop dc_workshop_log_2017_10_27.sh
+
+

It's important that we keep our workshop log file outside of our dc_workshop directory +if we want to use it to recreate our work. It's also important for us to keep it up to +date by regularly updating with the commands that we used to generate our results files.

+

Congratulations! You've finished your introduction to using the shell for genomics +projects. You now know how to navigate your file system, create, copy, move, +and remove files and directories, and automate repetitive tasks using scripts and +wildcards. With this solid foundation, you're ready to move on to apply all of these new +skills to carrying out more sophisticated bioinformatics +analysis work. Don't worry if everything doesn't feel perfectly comfortable yet. We're +going to have many more opportunities for practice as we move forward on our +bioinformatics journey!

+

References

+

A Quick Guide to Organizing Computational Biology Projects

+

:::::::::::::::::::::::::::::::::::::::: keypoints

+
    +
  • Spend the time to organize your file system when you start a new project. Your future self will thank you!
  • +
  • Always save a write-protected copy of your raw data.
  • +
+

::::::::::::::::::::::::::::::::::::::::::::::::::

+ + + + + + + + + + + + + +
+
+ + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/404.html b/404.html new file mode 100644 index 0000000..70174a3 --- /dev/null +++ b/404.html @@ -0,0 +1,478 @@ + + + + + + + + + + + + + + + + + + + + + Introduction to Shell for Bioinformatics + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ +
+
+ +
+ + + + + + +
+ + +
+ +
+ + + + + + +
+
+ + + +
+
+ +
+
+ + + +
+
+
+ + + +
+
+
+ + + +
+
+ +

404 - Not found

+ +
+
+ + + +
+ + + +
+ + + +
+
+
+
+ + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/assets/images/favicon.png b/assets/images/favicon.png new file mode 100644 index 0000000000000000000000000000000000000000..1cf13b9f9d978896599290a74f77d5dbe7d1655c GIT binary patch literal 1870 zcmV-U2eJ5xP)Gc)JR9QMau)O=X#!i9;T z37kk-upj^(fsR36MHs_+1RCI)NNu9}lD0S{B^g8PN?Ww(5|~L#Ng*g{WsqleV}|#l zz8@ri&cTzw_h33bHI+12+kK6WN$h#n5cD8OQt`5kw6p~9H3()bUQ8OS4Q4HTQ=1Ol z_JAocz`fLbT2^{`8n~UAo=#AUOf=SOq4pYkt;XbC&f#7lb$*7=$na!mWCQ`dBQsO0 zLFBSPj*N?#u5&pf2t4XjEGH|=pPQ8xh7tpx;US5Cx_Ju;!O`ya-yF`)b%TEt5>eP1ZX~}sjjA%FJF?h7cX8=b!DZl<6%Cv z*G0uvvU+vmnpLZ2paivG-(cd*y3$hCIcsZcYOGh{$&)A6*XX&kXZd3G8m)G$Zz-LV z^GF3VAW^Mdv!)4OM8EgqRiz~*Cji;uzl2uC9^=8I84vNp;ltJ|q-*uQwGp2ma6cY7 z;`%`!9UXO@fr&Ebapfs34OmS9^u6$)bJxrucutf>`dKPKT%%*d3XlFVKunp9 zasduxjrjs>f8V=D|J=XNZp;_Zy^WgQ$9WDjgY=z@stwiEBm9u5*|34&1Na8BMjjgf3+SHcr`5~>oz1Y?SW^=K z^bTyO6>Gar#P_W2gEMwq)ot3; zREHn~U&Dp0l6YT0&k-wLwYjb?5zGK`W6S2v+K>AM(95m2C20L|3m~rN8dprPr@t)5lsk9Hu*W z?pS990s;Ez=+Rj{x7p``4>+c0G5^pYnB1^!TL=(?HLHZ+HicG{~4F1d^5Awl_2!1jICM-!9eoLhbbT^;yHcefyTAaqRcY zmuctDopPT!%k+}x%lZRKnzykr2}}XfG_ne?nRQO~?%hkzo;@RN{P6o`&mMUWBYMTe z6i8ChtjX&gXl`nvrU>jah)2iNM%JdjqoaeaU%yVn!^70x-flljp6Q5tK}5}&X8&&G zX3fpb3E(!rH=zVI_9Gjl45w@{(ITqngWFe7@9{mX;tO25Z_8 zQHEpI+FkTU#4xu>RkN>b3Tnc3UpWzPXWm#o55GKF09j^Mh~)K7{QqbO_~(@CVq! zS<8954|P8mXN2MRs86xZ&Q4EfM@JB94b=(YGuk)s&^jiSF=t3*oNK3`rD{H`yQ?d; ztE=laAUoZx5?RC8*WKOj`%LXEkgDd>&^Q4M^z`%u0rg-It=hLCVsq!Z%^6eB-OvOT zFZ28TN&cRmgU}Elrnk43)!>Z1FCPL2K$7}gwzIc48NX}#!A1BpJP?#v5wkNprhV** z?Cpalt1oH&{r!o3eSKc&ap)iz2BTn_VV`4>9M^b3;(YY}4>#ML6{~(4mH+?%07*qo IM6N<$f(jP3KmY&$ literal 0 HcmV?d00001 diff --git a/assets/javascripts/bundle.fe8b6f2b.min.js b/assets/javascripts/bundle.fe8b6f2b.min.js new file mode 100644 index 0000000..cf778d4 --- /dev/null +++ b/assets/javascripts/bundle.fe8b6f2b.min.js @@ -0,0 +1,29 @@ +"use strict";(()=>{var Fi=Object.create;var gr=Object.defineProperty;var ji=Object.getOwnPropertyDescriptor;var Wi=Object.getOwnPropertyNames,Dt=Object.getOwnPropertySymbols,Ui=Object.getPrototypeOf,xr=Object.prototype.hasOwnProperty,no=Object.prototype.propertyIsEnumerable;var oo=(e,t,r)=>t in e?gr(e,t,{enumerable:!0,configurable:!0,writable:!0,value:r}):e[t]=r,R=(e,t)=>{for(var r in t||(t={}))xr.call(t,r)&&oo(e,r,t[r]);if(Dt)for(var r of Dt(t))no.call(t,r)&&oo(e,r,t[r]);return e};var io=(e,t)=>{var r={};for(var o in e)xr.call(e,o)&&t.indexOf(o)<0&&(r[o]=e[o]);if(e!=null&&Dt)for(var o of Dt(e))t.indexOf(o)<0&&no.call(e,o)&&(r[o]=e[o]);return r};var yr=(e,t)=>()=>(t||e((t={exports:{}}).exports,t),t.exports);var Di=(e,t,r,o)=>{if(t&&typeof t=="object"||typeof t=="function")for(let n of Wi(t))!xr.call(e,n)&&n!==r&&gr(e,n,{get:()=>t[n],enumerable:!(o=ji(t,n))||o.enumerable});return e};var Vt=(e,t,r)=>(r=e!=null?Fi(Ui(e)):{},Di(t||!e||!e.__esModule?gr(r,"default",{value:e,enumerable:!0}):r,e));var ao=(e,t,r)=>new Promise((o,n)=>{var i=p=>{try{s(r.next(p))}catch(c){n(c)}},a=p=>{try{s(r.throw(p))}catch(c){n(c)}},s=p=>p.done?o(p.value):Promise.resolve(p.value).then(i,a);s((r=r.apply(e,t)).next())});var co=yr((Er,so)=>{(function(e,t){typeof Er=="object"&&typeof so!="undefined"?t():typeof define=="function"&&define.amd?define(t):t()})(Er,function(){"use strict";function e(r){var o=!0,n=!1,i=null,a={text:!0,search:!0,url:!0,tel:!0,email:!0,password:!0,number:!0,date:!0,month:!0,week:!0,time:!0,datetime:!0,"datetime-local":!0};function s(H){return!!(H&&H!==document&&H.nodeName!=="HTML"&&H.nodeName!=="BODY"&&"classList"in H&&"contains"in H.classList)}function p(H){var mt=H.type,ze=H.tagName;return!!(ze==="INPUT"&&a[mt]&&!H.readOnly||ze==="TEXTAREA"&&!H.readOnly||H.isContentEditable)}function c(H){H.classList.contains("focus-visible")||(H.classList.add("focus-visible"),H.setAttribute("data-focus-visible-added",""))}function l(H){H.hasAttribute("data-focus-visible-added")&&(H.classList.remove("focus-visible"),H.removeAttribute("data-focus-visible-added"))}function f(H){H.metaKey||H.altKey||H.ctrlKey||(s(r.activeElement)&&c(r.activeElement),o=!0)}function u(H){o=!1}function h(H){s(H.target)&&(o||p(H.target))&&c(H.target)}function w(H){s(H.target)&&(H.target.classList.contains("focus-visible")||H.target.hasAttribute("data-focus-visible-added"))&&(n=!0,window.clearTimeout(i),i=window.setTimeout(function(){n=!1},100),l(H.target))}function A(H){document.visibilityState==="hidden"&&(n&&(o=!0),te())}function te(){document.addEventListener("mousemove",J),document.addEventListener("mousedown",J),document.addEventListener("mouseup",J),document.addEventListener("pointermove",J),document.addEventListener("pointerdown",J),document.addEventListener("pointerup",J),document.addEventListener("touchmove",J),document.addEventListener("touchstart",J),document.addEventListener("touchend",J)}function ie(){document.removeEventListener("mousemove",J),document.removeEventListener("mousedown",J),document.removeEventListener("mouseup",J),document.removeEventListener("pointermove",J),document.removeEventListener("pointerdown",J),document.removeEventListener("pointerup",J),document.removeEventListener("touchmove",J),document.removeEventListener("touchstart",J),document.removeEventListener("touchend",J)}function J(H){H.target.nodeName&&H.target.nodeName.toLowerCase()==="html"||(o=!1,ie())}document.addEventListener("keydown",f,!0),document.addEventListener("mousedown",u,!0),document.addEventListener("pointerdown",u,!0),document.addEventListener("touchstart",u,!0),document.addEventListener("visibilitychange",A,!0),te(),r.addEventListener("focus",h,!0),r.addEventListener("blur",w,!0),r.nodeType===Node.DOCUMENT_FRAGMENT_NODE&&r.host?r.host.setAttribute("data-js-focus-visible",""):r.nodeType===Node.DOCUMENT_NODE&&(document.documentElement.classList.add("js-focus-visible"),document.documentElement.setAttribute("data-js-focus-visible",""))}if(typeof window!="undefined"&&typeof document!="undefined"){window.applyFocusVisiblePolyfill=e;var t;try{t=new CustomEvent("focus-visible-polyfill-ready")}catch(r){t=document.createEvent("CustomEvent"),t.initCustomEvent("focus-visible-polyfill-ready",!1,!1,{})}window.dispatchEvent(t)}typeof document!="undefined"&&e(document)})});var Yr=yr((Rt,Kr)=>{/*! + * clipboard.js v2.0.11 + * https://clipboardjs.com/ + * + * Licensed MIT © Zeno Rocha + */(function(t,r){typeof Rt=="object"&&typeof Kr=="object"?Kr.exports=r():typeof define=="function"&&define.amd?define([],r):typeof Rt=="object"?Rt.ClipboardJS=r():t.ClipboardJS=r()})(Rt,function(){return function(){var e={686:function(o,n,i){"use strict";i.d(n,{default:function(){return Ii}});var a=i(279),s=i.n(a),p=i(370),c=i.n(p),l=i(817),f=i.n(l);function u(V){try{return document.execCommand(V)}catch(_){return!1}}var h=function(_){var M=f()(_);return u("cut"),M},w=h;function A(V){var _=document.documentElement.getAttribute("dir")==="rtl",M=document.createElement("textarea");M.style.fontSize="12pt",M.style.border="0",M.style.padding="0",M.style.margin="0",M.style.position="absolute",M.style[_?"right":"left"]="-9999px";var j=window.pageYOffset||document.documentElement.scrollTop;return M.style.top="".concat(j,"px"),M.setAttribute("readonly",""),M.value=V,M}var te=function(_,M){var j=A(_);M.container.appendChild(j);var D=f()(j);return u("copy"),j.remove(),D},ie=function(_){var M=arguments.length>1&&arguments[1]!==void 0?arguments[1]:{container:document.body},j="";return typeof _=="string"?j=te(_,M):_ instanceof HTMLInputElement&&!["text","search","url","tel","password"].includes(_==null?void 0:_.type)?j=te(_.value,M):(j=f()(_),u("copy")),j},J=ie;function H(V){"@babel/helpers - typeof";return typeof Symbol=="function"&&typeof Symbol.iterator=="symbol"?H=function(M){return typeof M}:H=function(M){return M&&typeof Symbol=="function"&&M.constructor===Symbol&&M!==Symbol.prototype?"symbol":typeof M},H(V)}var mt=function(){var _=arguments.length>0&&arguments[0]!==void 0?arguments[0]:{},M=_.action,j=M===void 0?"copy":M,D=_.container,Y=_.target,ke=_.text;if(j!=="copy"&&j!=="cut")throw new Error('Invalid "action" value, use either "copy" or "cut"');if(Y!==void 0)if(Y&&H(Y)==="object"&&Y.nodeType===1){if(j==="copy"&&Y.hasAttribute("disabled"))throw new Error('Invalid "target" attribute. Please use "readonly" instead of "disabled" attribute');if(j==="cut"&&(Y.hasAttribute("readonly")||Y.hasAttribute("disabled")))throw new Error(`Invalid "target" attribute. You can't cut text from elements with "readonly" or "disabled" attributes`)}else throw new Error('Invalid "target" value, use a valid Element');if(ke)return J(ke,{container:D});if(Y)return j==="cut"?w(Y):J(Y,{container:D})},ze=mt;function Ie(V){"@babel/helpers - typeof";return typeof Symbol=="function"&&typeof Symbol.iterator=="symbol"?Ie=function(M){return typeof M}:Ie=function(M){return M&&typeof Symbol=="function"&&M.constructor===Symbol&&M!==Symbol.prototype?"symbol":typeof M},Ie(V)}function _i(V,_){if(!(V instanceof _))throw new TypeError("Cannot call a class as a function")}function ro(V,_){for(var M=0;M<_.length;M++){var j=_[M];j.enumerable=j.enumerable||!1,j.configurable=!0,"value"in j&&(j.writable=!0),Object.defineProperty(V,j.key,j)}}function Ai(V,_,M){return _&&ro(V.prototype,_),M&&ro(V,M),V}function Ci(V,_){if(typeof _!="function"&&_!==null)throw new TypeError("Super expression must either be null or a function");V.prototype=Object.create(_&&_.prototype,{constructor:{value:V,writable:!0,configurable:!0}}),_&&br(V,_)}function br(V,_){return br=Object.setPrototypeOf||function(j,D){return j.__proto__=D,j},br(V,_)}function Hi(V){var _=Pi();return function(){var j=Wt(V),D;if(_){var Y=Wt(this).constructor;D=Reflect.construct(j,arguments,Y)}else D=j.apply(this,arguments);return ki(this,D)}}function ki(V,_){return _&&(Ie(_)==="object"||typeof _=="function")?_:$i(V)}function $i(V){if(V===void 0)throw new ReferenceError("this hasn't been initialised - super() hasn't been called");return V}function Pi(){if(typeof Reflect=="undefined"||!Reflect.construct||Reflect.construct.sham)return!1;if(typeof Proxy=="function")return!0;try{return Date.prototype.toString.call(Reflect.construct(Date,[],function(){})),!0}catch(V){return!1}}function Wt(V){return Wt=Object.setPrototypeOf?Object.getPrototypeOf:function(M){return M.__proto__||Object.getPrototypeOf(M)},Wt(V)}function vr(V,_){var M="data-clipboard-".concat(V);if(_.hasAttribute(M))return _.getAttribute(M)}var Ri=function(V){Ci(M,V);var _=Hi(M);function M(j,D){var Y;return _i(this,M),Y=_.call(this),Y.resolveOptions(D),Y.listenClick(j),Y}return Ai(M,[{key:"resolveOptions",value:function(){var D=arguments.length>0&&arguments[0]!==void 0?arguments[0]:{};this.action=typeof D.action=="function"?D.action:this.defaultAction,this.target=typeof D.target=="function"?D.target:this.defaultTarget,this.text=typeof D.text=="function"?D.text:this.defaultText,this.container=Ie(D.container)==="object"?D.container:document.body}},{key:"listenClick",value:function(D){var Y=this;this.listener=c()(D,"click",function(ke){return Y.onClick(ke)})}},{key:"onClick",value:function(D){var Y=D.delegateTarget||D.currentTarget,ke=this.action(Y)||"copy",Ut=ze({action:ke,container:this.container,target:this.target(Y),text:this.text(Y)});this.emit(Ut?"success":"error",{action:ke,text:Ut,trigger:Y,clearSelection:function(){Y&&Y.focus(),window.getSelection().removeAllRanges()}})}},{key:"defaultAction",value:function(D){return vr("action",D)}},{key:"defaultTarget",value:function(D){var Y=vr("target",D);if(Y)return document.querySelector(Y)}},{key:"defaultText",value:function(D){return vr("text",D)}},{key:"destroy",value:function(){this.listener.destroy()}}],[{key:"copy",value:function(D){var Y=arguments.length>1&&arguments[1]!==void 0?arguments[1]:{container:document.body};return J(D,Y)}},{key:"cut",value:function(D){return w(D)}},{key:"isSupported",value:function(){var D=arguments.length>0&&arguments[0]!==void 0?arguments[0]:["copy","cut"],Y=typeof D=="string"?[D]:D,ke=!!document.queryCommandSupported;return Y.forEach(function(Ut){ke=ke&&!!document.queryCommandSupported(Ut)}),ke}}]),M}(s()),Ii=Ri},828:function(o){var n=9;if(typeof Element!="undefined"&&!Element.prototype.matches){var i=Element.prototype;i.matches=i.matchesSelector||i.mozMatchesSelector||i.msMatchesSelector||i.oMatchesSelector||i.webkitMatchesSelector}function a(s,p){for(;s&&s.nodeType!==n;){if(typeof s.matches=="function"&&s.matches(p))return s;s=s.parentNode}}o.exports=a},438:function(o,n,i){var a=i(828);function s(l,f,u,h,w){var A=c.apply(this,arguments);return l.addEventListener(u,A,w),{destroy:function(){l.removeEventListener(u,A,w)}}}function p(l,f,u,h,w){return typeof l.addEventListener=="function"?s.apply(null,arguments):typeof u=="function"?s.bind(null,document).apply(null,arguments):(typeof l=="string"&&(l=document.querySelectorAll(l)),Array.prototype.map.call(l,function(A){return s(A,f,u,h,w)}))}function c(l,f,u,h){return function(w){w.delegateTarget=a(w.target,f),w.delegateTarget&&h.call(l,w)}}o.exports=p},879:function(o,n){n.node=function(i){return i!==void 0&&i instanceof HTMLElement&&i.nodeType===1},n.nodeList=function(i){var a=Object.prototype.toString.call(i);return i!==void 0&&(a==="[object NodeList]"||a==="[object HTMLCollection]")&&"length"in i&&(i.length===0||n.node(i[0]))},n.string=function(i){return typeof i=="string"||i instanceof String},n.fn=function(i){var a=Object.prototype.toString.call(i);return a==="[object Function]"}},370:function(o,n,i){var a=i(879),s=i(438);function p(u,h,w){if(!u&&!h&&!w)throw new Error("Missing required arguments");if(!a.string(h))throw new TypeError("Second argument must be a String");if(!a.fn(w))throw new TypeError("Third argument must be a Function");if(a.node(u))return c(u,h,w);if(a.nodeList(u))return l(u,h,w);if(a.string(u))return f(u,h,w);throw new TypeError("First argument must be a String, HTMLElement, HTMLCollection, or NodeList")}function c(u,h,w){return u.addEventListener(h,w),{destroy:function(){u.removeEventListener(h,w)}}}function l(u,h,w){return Array.prototype.forEach.call(u,function(A){A.addEventListener(h,w)}),{destroy:function(){Array.prototype.forEach.call(u,function(A){A.removeEventListener(h,w)})}}}function f(u,h,w){return s(document.body,u,h,w)}o.exports=p},817:function(o){function n(i){var a;if(i.nodeName==="SELECT")i.focus(),a=i.value;else if(i.nodeName==="INPUT"||i.nodeName==="TEXTAREA"){var s=i.hasAttribute("readonly");s||i.setAttribute("readonly",""),i.select(),i.setSelectionRange(0,i.value.length),s||i.removeAttribute("readonly"),a=i.value}else{i.hasAttribute("contenteditable")&&i.focus();var p=window.getSelection(),c=document.createRange();c.selectNodeContents(i),p.removeAllRanges(),p.addRange(c),a=p.toString()}return a}o.exports=n},279:function(o){function n(){}n.prototype={on:function(i,a,s){var p=this.e||(this.e={});return(p[i]||(p[i]=[])).push({fn:a,ctx:s}),this},once:function(i,a,s){var p=this;function c(){p.off(i,c),a.apply(s,arguments)}return c._=a,this.on(i,c,s)},emit:function(i){var a=[].slice.call(arguments,1),s=((this.e||(this.e={}))[i]||[]).slice(),p=0,c=s.length;for(p;p{"use strict";/*! + * escape-html + * Copyright(c) 2012-2013 TJ Holowaychuk + * Copyright(c) 2015 Andreas Lubbe + * Copyright(c) 2015 Tiancheng "Timothy" Gu + * MIT Licensed + */var ts=/["'&<>]/;ei.exports=rs;function rs(e){var t=""+e,r=ts.exec(t);if(!r)return t;var o,n="",i=0,a=0;for(i=r.index;i0&&i[i.length-1])&&(c[0]===6||c[0]===2)){r=0;continue}if(c[0]===3&&(!i||c[1]>i[0]&&c[1]=e.length&&(e=void 0),{value:e&&e[o++],done:!e}}};throw new TypeError(t?"Object is not iterable.":"Symbol.iterator is not defined.")}function N(e,t){var r=typeof Symbol=="function"&&e[Symbol.iterator];if(!r)return e;var o=r.call(e),n,i=[],a;try{for(;(t===void 0||t-- >0)&&!(n=o.next()).done;)i.push(n.value)}catch(s){a={error:s}}finally{try{n&&!n.done&&(r=o.return)&&r.call(o)}finally{if(a)throw a.error}}return i}function q(e,t,r){if(r||arguments.length===2)for(var o=0,n=t.length,i;o1||s(u,h)})})}function s(u,h){try{p(o[u](h))}catch(w){f(i[0][3],w)}}function p(u){u.value instanceof nt?Promise.resolve(u.value.v).then(c,l):f(i[0][2],u)}function c(u){s("next",u)}function l(u){s("throw",u)}function f(u,h){u(h),i.shift(),i.length&&s(i[0][0],i[0][1])}}function mo(e){if(!Symbol.asyncIterator)throw new TypeError("Symbol.asyncIterator is not defined.");var t=e[Symbol.asyncIterator],r;return t?t.call(e):(e=typeof de=="function"?de(e):e[Symbol.iterator](),r={},o("next"),o("throw"),o("return"),r[Symbol.asyncIterator]=function(){return this},r);function o(i){r[i]=e[i]&&function(a){return new Promise(function(s,p){a=e[i](a),n(s,p,a.done,a.value)})}}function n(i,a,s,p){Promise.resolve(p).then(function(c){i({value:c,done:s})},a)}}function k(e){return typeof e=="function"}function ft(e){var t=function(o){Error.call(o),o.stack=new Error().stack},r=e(t);return r.prototype=Object.create(Error.prototype),r.prototype.constructor=r,r}var zt=ft(function(e){return function(r){e(this),this.message=r?r.length+` errors occurred during unsubscription: +`+r.map(function(o,n){return n+1+") "+o.toString()}).join(` + `):"",this.name="UnsubscriptionError",this.errors=r}});function qe(e,t){if(e){var r=e.indexOf(t);0<=r&&e.splice(r,1)}}var Fe=function(){function e(t){this.initialTeardown=t,this.closed=!1,this._parentage=null,this._finalizers=null}return e.prototype.unsubscribe=function(){var t,r,o,n,i;if(!this.closed){this.closed=!0;var a=this._parentage;if(a)if(this._parentage=null,Array.isArray(a))try{for(var s=de(a),p=s.next();!p.done;p=s.next()){var c=p.value;c.remove(this)}}catch(A){t={error:A}}finally{try{p&&!p.done&&(r=s.return)&&r.call(s)}finally{if(t)throw t.error}}else a.remove(this);var l=this.initialTeardown;if(k(l))try{l()}catch(A){i=A instanceof zt?A.errors:[A]}var f=this._finalizers;if(f){this._finalizers=null;try{for(var u=de(f),h=u.next();!h.done;h=u.next()){var w=h.value;try{fo(w)}catch(A){i=i!=null?i:[],A instanceof zt?i=q(q([],N(i)),N(A.errors)):i.push(A)}}}catch(A){o={error:A}}finally{try{h&&!h.done&&(n=u.return)&&n.call(u)}finally{if(o)throw o.error}}}if(i)throw new zt(i)}},e.prototype.add=function(t){var r;if(t&&t!==this)if(this.closed)fo(t);else{if(t instanceof e){if(t.closed||t._hasParent(this))return;t._addParent(this)}(this._finalizers=(r=this._finalizers)!==null&&r!==void 0?r:[]).push(t)}},e.prototype._hasParent=function(t){var r=this._parentage;return r===t||Array.isArray(r)&&r.includes(t)},e.prototype._addParent=function(t){var r=this._parentage;this._parentage=Array.isArray(r)?(r.push(t),r):r?[r,t]:t},e.prototype._removeParent=function(t){var r=this._parentage;r===t?this._parentage=null:Array.isArray(r)&&qe(r,t)},e.prototype.remove=function(t){var r=this._finalizers;r&&qe(r,t),t instanceof e&&t._removeParent(this)},e.EMPTY=function(){var t=new e;return t.closed=!0,t}(),e}();var Tr=Fe.EMPTY;function qt(e){return e instanceof Fe||e&&"closed"in e&&k(e.remove)&&k(e.add)&&k(e.unsubscribe)}function fo(e){k(e)?e():e.unsubscribe()}var $e={onUnhandledError:null,onStoppedNotification:null,Promise:void 0,useDeprecatedSynchronousErrorHandling:!1,useDeprecatedNextContext:!1};var ut={setTimeout:function(e,t){for(var r=[],o=2;o0},enumerable:!1,configurable:!0}),t.prototype._trySubscribe=function(r){return this._throwIfClosed(),e.prototype._trySubscribe.call(this,r)},t.prototype._subscribe=function(r){return this._throwIfClosed(),this._checkFinalizedStatuses(r),this._innerSubscribe(r)},t.prototype._innerSubscribe=function(r){var o=this,n=this,i=n.hasError,a=n.isStopped,s=n.observers;return i||a?Tr:(this.currentObservers=null,s.push(r),new Fe(function(){o.currentObservers=null,qe(s,r)}))},t.prototype._checkFinalizedStatuses=function(r){var o=this,n=o.hasError,i=o.thrownError,a=o.isStopped;n?r.error(i):a&&r.complete()},t.prototype.asObservable=function(){var r=new F;return r.source=this,r},t.create=function(r,o){return new Eo(r,o)},t}(F);var Eo=function(e){re(t,e);function t(r,o){var n=e.call(this)||this;return n.destination=r,n.source=o,n}return t.prototype.next=function(r){var o,n;(n=(o=this.destination)===null||o===void 0?void 0:o.next)===null||n===void 0||n.call(o,r)},t.prototype.error=function(r){var o,n;(n=(o=this.destination)===null||o===void 0?void 0:o.error)===null||n===void 0||n.call(o,r)},t.prototype.complete=function(){var r,o;(o=(r=this.destination)===null||r===void 0?void 0:r.complete)===null||o===void 0||o.call(r)},t.prototype._subscribe=function(r){var o,n;return(n=(o=this.source)===null||o===void 0?void 0:o.subscribe(r))!==null&&n!==void 0?n:Tr},t}(g);var _r=function(e){re(t,e);function t(r){var o=e.call(this)||this;return o._value=r,o}return Object.defineProperty(t.prototype,"value",{get:function(){return this.getValue()},enumerable:!1,configurable:!0}),t.prototype._subscribe=function(r){var o=e.prototype._subscribe.call(this,r);return!o.closed&&r.next(this._value),o},t.prototype.getValue=function(){var r=this,o=r.hasError,n=r.thrownError,i=r._value;if(o)throw n;return this._throwIfClosed(),i},t.prototype.next=function(r){e.prototype.next.call(this,this._value=r)},t}(g);var Lt={now:function(){return(Lt.delegate||Date).now()},delegate:void 0};var _t=function(e){re(t,e);function t(r,o,n){r===void 0&&(r=1/0),o===void 0&&(o=1/0),n===void 0&&(n=Lt);var i=e.call(this)||this;return i._bufferSize=r,i._windowTime=o,i._timestampProvider=n,i._buffer=[],i._infiniteTimeWindow=!0,i._infiniteTimeWindow=o===1/0,i._bufferSize=Math.max(1,r),i._windowTime=Math.max(1,o),i}return t.prototype.next=function(r){var o=this,n=o.isStopped,i=o._buffer,a=o._infiniteTimeWindow,s=o._timestampProvider,p=o._windowTime;n||(i.push(r),!a&&i.push(s.now()+p)),this._trimBuffer(),e.prototype.next.call(this,r)},t.prototype._subscribe=function(r){this._throwIfClosed(),this._trimBuffer();for(var o=this._innerSubscribe(r),n=this,i=n._infiniteTimeWindow,a=n._buffer,s=a.slice(),p=0;p0?e.prototype.schedule.call(this,r,o):(this.delay=o,this.state=r,this.scheduler.flush(this),this)},t.prototype.execute=function(r,o){return o>0||this.closed?e.prototype.execute.call(this,r,o):this._execute(r,o)},t.prototype.requestAsyncId=function(r,o,n){return n===void 0&&(n=0),n!=null&&n>0||n==null&&this.delay>0?e.prototype.requestAsyncId.call(this,r,o,n):(r.flush(this),0)},t}(vt);var So=function(e){re(t,e);function t(){return e!==null&&e.apply(this,arguments)||this}return t}(gt);var Hr=new So(To);var Oo=function(e){re(t,e);function t(r,o){var n=e.call(this,r,o)||this;return n.scheduler=r,n.work=o,n}return t.prototype.requestAsyncId=function(r,o,n){return n===void 0&&(n=0),n!==null&&n>0?e.prototype.requestAsyncId.call(this,r,o,n):(r.actions.push(this),r._scheduled||(r._scheduled=bt.requestAnimationFrame(function(){return r.flush(void 0)})))},t.prototype.recycleAsyncId=function(r,o,n){var i;if(n===void 0&&(n=0),n!=null?n>0:this.delay>0)return e.prototype.recycleAsyncId.call(this,r,o,n);var a=r.actions;o!=null&&((i=a[a.length-1])===null||i===void 0?void 0:i.id)!==o&&(bt.cancelAnimationFrame(o),r._scheduled=void 0)},t}(vt);var Mo=function(e){re(t,e);function t(){return e!==null&&e.apply(this,arguments)||this}return t.prototype.flush=function(r){this._active=!0;var o=this._scheduled;this._scheduled=void 0;var n=this.actions,i;r=r||n.shift();do if(i=r.execute(r.state,r.delay))break;while((r=n[0])&&r.id===o&&n.shift());if(this._active=!1,i){for(;(r=n[0])&&r.id===o&&n.shift();)r.unsubscribe();throw i}},t}(gt);var me=new Mo(Oo);var O=new F(function(e){return e.complete()});function Yt(e){return e&&k(e.schedule)}function kr(e){return e[e.length-1]}function Xe(e){return k(kr(e))?e.pop():void 0}function He(e){return Yt(kr(e))?e.pop():void 0}function Bt(e,t){return typeof kr(e)=="number"?e.pop():t}var xt=function(e){return e&&typeof e.length=="number"&&typeof e!="function"};function Gt(e){return k(e==null?void 0:e.then)}function Jt(e){return k(e[ht])}function Xt(e){return Symbol.asyncIterator&&k(e==null?void 0:e[Symbol.asyncIterator])}function Zt(e){return new TypeError("You provided "+(e!==null&&typeof e=="object"?"an invalid object":"'"+e+"'")+" where a stream was expected. You can provide an Observable, Promise, ReadableStream, Array, AsyncIterable, or Iterable.")}function Gi(){return typeof Symbol!="function"||!Symbol.iterator?"@@iterator":Symbol.iterator}var er=Gi();function tr(e){return k(e==null?void 0:e[er])}function rr(e){return lo(this,arguments,function(){var r,o,n,i;return Nt(this,function(a){switch(a.label){case 0:r=e.getReader(),a.label=1;case 1:a.trys.push([1,,9,10]),a.label=2;case 2:return[4,nt(r.read())];case 3:return o=a.sent(),n=o.value,i=o.done,i?[4,nt(void 0)]:[3,5];case 4:return[2,a.sent()];case 5:return[4,nt(n)];case 6:return[4,a.sent()];case 7:return a.sent(),[3,2];case 8:return[3,10];case 9:return r.releaseLock(),[7];case 10:return[2]}})})}function or(e){return k(e==null?void 0:e.getReader)}function W(e){if(e instanceof F)return e;if(e!=null){if(Jt(e))return Ji(e);if(xt(e))return Xi(e);if(Gt(e))return Zi(e);if(Xt(e))return Lo(e);if(tr(e))return ea(e);if(or(e))return ta(e)}throw Zt(e)}function Ji(e){return new F(function(t){var r=e[ht]();if(k(r.subscribe))return r.subscribe(t);throw new TypeError("Provided object does not correctly implement Symbol.observable")})}function Xi(e){return new F(function(t){for(var r=0;r=2;return function(o){return o.pipe(e?b(function(n,i){return e(n,i,o)}):le,Te(1),r?Be(t):zo(function(){return new ir}))}}function Fr(e){return e<=0?function(){return O}:y(function(t,r){var o=[];t.subscribe(T(r,function(n){o.push(n),e=2,!0))}function pe(e){e===void 0&&(e={});var t=e.connector,r=t===void 0?function(){return new g}:t,o=e.resetOnError,n=o===void 0?!0:o,i=e.resetOnComplete,a=i===void 0?!0:i,s=e.resetOnRefCountZero,p=s===void 0?!0:s;return function(c){var l,f,u,h=0,w=!1,A=!1,te=function(){f==null||f.unsubscribe(),f=void 0},ie=function(){te(),l=u=void 0,w=A=!1},J=function(){var H=l;ie(),H==null||H.unsubscribe()};return y(function(H,mt){h++,!A&&!w&&te();var ze=u=u!=null?u:r();mt.add(function(){h--,h===0&&!A&&!w&&(f=Wr(J,p))}),ze.subscribe(mt),!l&&h>0&&(l=new at({next:function(Ie){return ze.next(Ie)},error:function(Ie){A=!0,te(),f=Wr(ie,n,Ie),ze.error(Ie)},complete:function(){w=!0,te(),f=Wr(ie,a),ze.complete()}}),W(H).subscribe(l))})(c)}}function Wr(e,t){for(var r=[],o=2;oe.next(document)),e}function $(e,t=document){return Array.from(t.querySelectorAll(e))}function P(e,t=document){let r=fe(e,t);if(typeof r=="undefined")throw new ReferenceError(`Missing element: expected "${e}" to be present`);return r}function fe(e,t=document){return t.querySelector(e)||void 0}function Re(){var e,t,r,o;return(o=(r=(t=(e=document.activeElement)==null?void 0:e.shadowRoot)==null?void 0:t.activeElement)!=null?r:document.activeElement)!=null?o:void 0}var xa=S(d(document.body,"focusin"),d(document.body,"focusout")).pipe(_e(1),Q(void 0),m(()=>Re()||document.body),G(1));function et(e){return xa.pipe(m(t=>e.contains(t)),K())}function kt(e,t){return C(()=>S(d(e,"mouseenter").pipe(m(()=>!0)),d(e,"mouseleave").pipe(m(()=>!1))).pipe(t?Ht(r=>Me(+!r*t)):le,Q(e.matches(":hover"))))}function Bo(e,t){if(typeof t=="string"||typeof t=="number")e.innerHTML+=t.toString();else if(t instanceof Node)e.appendChild(t);else if(Array.isArray(t))for(let r of t)Bo(e,r)}function x(e,t,...r){let o=document.createElement(e);if(t)for(let n of Object.keys(t))typeof t[n]!="undefined"&&(typeof t[n]!="boolean"?o.setAttribute(n,t[n]):o.setAttribute(n,""));for(let n of r)Bo(o,n);return o}function sr(e){if(e>999){let t=+((e-950)%1e3>99);return`${((e+1e-6)/1e3).toFixed(t)}k`}else return e.toString()}function wt(e){let t=x("script",{src:e});return C(()=>(document.head.appendChild(t),S(d(t,"load"),d(t,"error").pipe(v(()=>$r(()=>new ReferenceError(`Invalid script: ${e}`))))).pipe(m(()=>{}),L(()=>document.head.removeChild(t)),Te(1))))}var Go=new g,ya=C(()=>typeof ResizeObserver=="undefined"?wt("https://unpkg.com/resize-observer-polyfill"):I(void 0)).pipe(m(()=>new ResizeObserver(e=>e.forEach(t=>Go.next(t)))),v(e=>S(Ke,I(e)).pipe(L(()=>e.disconnect()))),G(1));function ce(e){return{width:e.offsetWidth,height:e.offsetHeight}}function ge(e){let t=e;for(;t.clientWidth===0&&t.parentElement;)t=t.parentElement;return ya.pipe(E(r=>r.observe(t)),v(r=>Go.pipe(b(o=>o.target===t),L(()=>r.unobserve(t)))),m(()=>ce(e)),Q(ce(e)))}function Tt(e){return{width:e.scrollWidth,height:e.scrollHeight}}function cr(e){let t=e.parentElement;for(;t&&(e.scrollWidth<=t.scrollWidth&&e.scrollHeight<=t.scrollHeight);)t=(e=t).parentElement;return t?e:void 0}function Jo(e){let t=[],r=e.parentElement;for(;r;)(e.clientWidth>r.clientWidth||e.clientHeight>r.clientHeight)&&t.push(r),r=(e=r).parentElement;return t.length===0&&t.push(document.documentElement),t}function Ue(e){return{x:e.offsetLeft,y:e.offsetTop}}function Xo(e){let t=e.getBoundingClientRect();return{x:t.x+window.scrollX,y:t.y+window.scrollY}}function Zo(e){return S(d(window,"load"),d(window,"resize")).pipe(Le(0,me),m(()=>Ue(e)),Q(Ue(e)))}function pr(e){return{x:e.scrollLeft,y:e.scrollTop}}function De(e){return S(d(e,"scroll"),d(window,"scroll"),d(window,"resize")).pipe(Le(0,me),m(()=>pr(e)),Q(pr(e)))}var en=new g,Ea=C(()=>I(new IntersectionObserver(e=>{for(let t of e)en.next(t)},{threshold:0}))).pipe(v(e=>S(Ke,I(e)).pipe(L(()=>e.disconnect()))),G(1));function tt(e){return Ea.pipe(E(t=>t.observe(e)),v(t=>en.pipe(b(({target:r})=>r===e),L(()=>t.unobserve(e)),m(({isIntersecting:r})=>r))))}function tn(e,t=16){return De(e).pipe(m(({y:r})=>{let o=ce(e),n=Tt(e);return r>=n.height-o.height-t}),K())}var lr={drawer:P("[data-md-toggle=drawer]"),search:P("[data-md-toggle=search]")};function rn(e){return lr[e].checked}function Je(e,t){lr[e].checked!==t&&lr[e].click()}function Ve(e){let t=lr[e];return d(t,"change").pipe(m(()=>t.checked),Q(t.checked))}function wa(e,t){switch(e.constructor){case HTMLInputElement:return e.type==="radio"?/^Arrow/.test(t):!0;case HTMLSelectElement:case HTMLTextAreaElement:return!0;default:return e.isContentEditable}}function Ta(){return S(d(window,"compositionstart").pipe(m(()=>!0)),d(window,"compositionend").pipe(m(()=>!1))).pipe(Q(!1))}function on(){let e=d(window,"keydown").pipe(b(t=>!(t.metaKey||t.ctrlKey)),m(t=>({mode:rn("search")?"search":"global",type:t.key,claim(){t.preventDefault(),t.stopPropagation()}})),b(({mode:t,type:r})=>{if(t==="global"){let o=Re();if(typeof o!="undefined")return!wa(o,r)}return!0}),pe());return Ta().pipe(v(t=>t?O:e))}function xe(){return new URL(location.href)}function pt(e,t=!1){if(B("navigation.instant")&&!t){let r=x("a",{href:e.href});document.body.appendChild(r),r.click(),r.remove()}else location.href=e.href}function nn(){return new g}function an(){return location.hash.slice(1)}function sn(e){let t=x("a",{href:e});t.addEventListener("click",r=>r.stopPropagation()),t.click()}function Sa(e){return S(d(window,"hashchange"),e).pipe(m(an),Q(an()),b(t=>t.length>0),G(1))}function cn(e){return Sa(e).pipe(m(t=>fe(`[id="${t}"]`)),b(t=>typeof t!="undefined"))}function $t(e){let t=matchMedia(e);return ar(r=>t.addListener(()=>r(t.matches))).pipe(Q(t.matches))}function pn(){let e=matchMedia("print");return S(d(window,"beforeprint").pipe(m(()=>!0)),d(window,"afterprint").pipe(m(()=>!1))).pipe(Q(e.matches))}function Nr(e,t){return e.pipe(v(r=>r?t():O))}function zr(e,t){return new F(r=>{let o=new XMLHttpRequest;return o.open("GET",`${e}`),o.responseType="blob",o.addEventListener("load",()=>{o.status>=200&&o.status<300?(r.next(o.response),r.complete()):r.error(new Error(o.statusText))}),o.addEventListener("error",()=>{r.error(new Error("Network error"))}),o.addEventListener("abort",()=>{r.complete()}),typeof(t==null?void 0:t.progress$)!="undefined"&&(o.addEventListener("progress",n=>{var i;if(n.lengthComputable)t.progress$.next(n.loaded/n.total*100);else{let a=(i=o.getResponseHeader("Content-Length"))!=null?i:0;t.progress$.next(n.loaded/+a*100)}}),t.progress$.next(5)),o.send(),()=>o.abort()})}function Ne(e,t){return zr(e,t).pipe(v(r=>r.text()),m(r=>JSON.parse(r)),G(1))}function ln(e,t){let r=new DOMParser;return zr(e,t).pipe(v(o=>o.text()),m(o=>r.parseFromString(o,"text/html")),G(1))}function mn(e,t){let r=new DOMParser;return zr(e,t).pipe(v(o=>o.text()),m(o=>r.parseFromString(o,"text/xml")),G(1))}function fn(){return{x:Math.max(0,scrollX),y:Math.max(0,scrollY)}}function un(){return S(d(window,"scroll",{passive:!0}),d(window,"resize",{passive:!0})).pipe(m(fn),Q(fn()))}function dn(){return{width:innerWidth,height:innerHeight}}function hn(){return d(window,"resize",{passive:!0}).pipe(m(dn),Q(dn()))}function bn(){return z([un(),hn()]).pipe(m(([e,t])=>({offset:e,size:t})),G(1))}function mr(e,{viewport$:t,header$:r}){let o=t.pipe(Z("size")),n=z([o,r]).pipe(m(()=>Ue(e)));return z([r,t,n]).pipe(m(([{height:i},{offset:a,size:s},{x:p,y:c}])=>({offset:{x:a.x-p,y:a.y-c+i},size:s})))}function Oa(e){return d(e,"message",t=>t.data)}function Ma(e){let t=new g;return t.subscribe(r=>e.postMessage(r)),t}function vn(e,t=new Worker(e)){let r=Oa(t),o=Ma(t),n=new g;n.subscribe(o);let i=o.pipe(X(),ne(!0));return n.pipe(X(),Pe(r.pipe(U(i))),pe())}var La=P("#__config"),St=JSON.parse(La.textContent);St.base=`${new URL(St.base,xe())}`;function ye(){return St}function B(e){return St.features.includes(e)}function Ee(e,t){return typeof t!="undefined"?St.translations[e].replace("#",t.toString()):St.translations[e]}function Se(e,t=document){return P(`[data-md-component=${e}]`,t)}function ae(e,t=document){return $(`[data-md-component=${e}]`,t)}function _a(e){let t=P(".md-typeset > :first-child",e);return d(t,"click",{once:!0}).pipe(m(()=>P(".md-typeset",e)),m(r=>({hash:__md_hash(r.innerHTML)})))}function gn(e){if(!B("announce.dismiss")||!e.childElementCount)return O;if(!e.hidden){let t=P(".md-typeset",e);__md_hash(t.innerHTML)===__md_get("__announce")&&(e.hidden=!0)}return C(()=>{let t=new g;return t.subscribe(({hash:r})=>{e.hidden=!0,__md_set("__announce",r)}),_a(e).pipe(E(r=>t.next(r)),L(()=>t.complete()),m(r=>R({ref:e},r)))})}function Aa(e,{target$:t}){return t.pipe(m(r=>({hidden:r!==e})))}function xn(e,t){let r=new g;return r.subscribe(({hidden:o})=>{e.hidden=o}),Aa(e,t).pipe(E(o=>r.next(o)),L(()=>r.complete()),m(o=>R({ref:e},o)))}function Pt(e,t){return t==="inline"?x("div",{class:"md-tooltip md-tooltip--inline",id:e,role:"tooltip"},x("div",{class:"md-tooltip__inner md-typeset"})):x("div",{class:"md-tooltip",id:e,role:"tooltip"},x("div",{class:"md-tooltip__inner md-typeset"}))}function yn(...e){return x("div",{class:"md-tooltip2",role:"tooltip"},x("div",{class:"md-tooltip2__inner md-typeset"},e))}function En(e,t){if(t=t?`${t}_annotation_${e}`:void 0,t){let r=t?`#${t}`:void 0;return x("aside",{class:"md-annotation",tabIndex:0},Pt(t),x("a",{href:r,class:"md-annotation__index",tabIndex:-1},x("span",{"data-md-annotation-id":e})))}else return x("aside",{class:"md-annotation",tabIndex:0},Pt(t),x("span",{class:"md-annotation__index",tabIndex:-1},x("span",{"data-md-annotation-id":e})))}function wn(e){return x("button",{class:"md-clipboard md-icon",title:Ee("clipboard.copy"),"data-clipboard-target":`#${e} > code`})}function qr(e,t){let r=t&2,o=t&1,n=Object.keys(e.terms).filter(p=>!e.terms[p]).reduce((p,c)=>[...p,x("del",null,c)," "],[]).slice(0,-1),i=ye(),a=new URL(e.location,i.base);B("search.highlight")&&a.searchParams.set("h",Object.entries(e.terms).filter(([,p])=>p).reduce((p,[c])=>`${p} ${c}`.trim(),""));let{tags:s}=ye();return x("a",{href:`${a}`,class:"md-search-result__link",tabIndex:-1},x("article",{class:"md-search-result__article md-typeset","data-md-score":e.score.toFixed(2)},r>0&&x("div",{class:"md-search-result__icon md-icon"}),r>0&&x("h1",null,e.title),r<=0&&x("h2",null,e.title),o>0&&e.text.length>0&&e.text,e.tags&&e.tags.map(p=>{let c=s?p in s?`md-tag-icon md-tag--${s[p]}`:"md-tag-icon":"";return x("span",{class:`md-tag ${c}`},p)}),o>0&&n.length>0&&x("p",{class:"md-search-result__terms"},Ee("search.result.term.missing"),": ",...n)))}function Tn(e){let t=e[0].score,r=[...e],o=ye(),n=r.findIndex(l=>!`${new URL(l.location,o.base)}`.includes("#")),[i]=r.splice(n,1),a=r.findIndex(l=>l.scoreqr(l,1)),...p.length?[x("details",{class:"md-search-result__more"},x("summary",{tabIndex:-1},x("div",null,p.length>0&&p.length===1?Ee("search.result.more.one"):Ee("search.result.more.other",p.length))),...p.map(l=>qr(l,1)))]:[]];return x("li",{class:"md-search-result__item"},c)}function Sn(e){return x("ul",{class:"md-source__facts"},Object.entries(e).map(([t,r])=>x("li",{class:`md-source__fact md-source__fact--${t}`},typeof r=="number"?sr(r):r)))}function Qr(e){let t=`tabbed-control tabbed-control--${e}`;return x("div",{class:t,hidden:!0},x("button",{class:"tabbed-button",tabIndex:-1,"aria-hidden":"true"}))}function On(e){return x("div",{class:"md-typeset__scrollwrap"},x("div",{class:"md-typeset__table"},e))}function Ca(e){var o;let t=ye(),r=new URL(`../${e.version}/`,t.base);return x("li",{class:"md-version__item"},x("a",{href:`${r}`,class:"md-version__link"},e.title,((o=t.version)==null?void 0:o.alias)&&e.aliases.length>0&&x("span",{class:"md-version__alias"},e.aliases[0])))}function Mn(e,t){var o;let r=ye();return e=e.filter(n=>{var i;return!((i=n.properties)!=null&&i.hidden)}),x("div",{class:"md-version"},x("button",{class:"md-version__current","aria-label":Ee("select.version")},t.title,((o=r.version)==null?void 0:o.alias)&&t.aliases.length>0&&x("span",{class:"md-version__alias"},t.aliases[0])),x("ul",{class:"md-version__list"},e.map(Ca)))}var Ha=0;function ka(e){let t=z([et(e),kt(e)]).pipe(m(([o,n])=>o||n),K()),r=C(()=>Jo(e)).pipe(oe(De),ct(1),m(()=>Xo(e)));return t.pipe(Ae(o=>o),v(()=>z([t,r])),m(([o,n])=>({active:o,offset:n})),pe())}function $a(e,t){let{content$:r,viewport$:o}=t,n=`__tooltip2_${Ha++}`;return C(()=>{let i=new g,a=new _r(!1);i.pipe(X(),ne(!1)).subscribe(a);let s=a.pipe(Ht(c=>Me(+!c*250,Hr)),K(),v(c=>c?r:O),E(c=>c.id=n),pe());z([i.pipe(m(({active:c})=>c)),s.pipe(v(c=>kt(c,250)),Q(!1))]).pipe(m(c=>c.some(l=>l))).subscribe(a);let p=a.pipe(b(c=>c),ee(s,o),m(([c,l,{size:f}])=>{let u=e.getBoundingClientRect(),h=u.width/2;if(l.role==="tooltip")return{x:h,y:8+u.height};if(u.y>=f.height/2){let{height:w}=ce(l);return{x:h,y:-16-w}}else return{x:h,y:16+u.height}}));return z([s,i,p]).subscribe(([c,{offset:l},f])=>{c.style.setProperty("--md-tooltip-host-x",`${l.x}px`),c.style.setProperty("--md-tooltip-host-y",`${l.y}px`),c.style.setProperty("--md-tooltip-x",`${f.x}px`),c.style.setProperty("--md-tooltip-y",`${f.y}px`),c.classList.toggle("md-tooltip2--top",f.y<0),c.classList.toggle("md-tooltip2--bottom",f.y>=0)}),a.pipe(b(c=>c),ee(s,(c,l)=>l),b(c=>c.role==="tooltip")).subscribe(c=>{let l=ce(P(":scope > *",c));c.style.setProperty("--md-tooltip-width",`${l.width}px`),c.style.setProperty("--md-tooltip-tail","0px")}),a.pipe(K(),be(me),ee(s)).subscribe(([c,l])=>{l.classList.toggle("md-tooltip2--active",c)}),z([a.pipe(b(c=>c)),s]).subscribe(([c,l])=>{l.role==="dialog"?(e.setAttribute("aria-controls",n),e.setAttribute("aria-haspopup","dialog")):e.setAttribute("aria-describedby",n)}),a.pipe(b(c=>!c)).subscribe(()=>{e.removeAttribute("aria-controls"),e.removeAttribute("aria-describedby"),e.removeAttribute("aria-haspopup")}),ka(e).pipe(E(c=>i.next(c)),L(()=>i.complete()),m(c=>R({ref:e},c)))})}function lt(e,{viewport$:t},r=document.body){return $a(e,{content$:new F(o=>{let n=e.title,i=yn(n);return o.next(i),e.removeAttribute("title"),r.append(i),()=>{i.remove(),e.setAttribute("title",n)}}),viewport$:t})}function Pa(e,t){let r=C(()=>z([Zo(e),De(t)])).pipe(m(([{x:o,y:n},i])=>{let{width:a,height:s}=ce(e);return{x:o-i.x+a/2,y:n-i.y+s/2}}));return et(e).pipe(v(o=>r.pipe(m(n=>({active:o,offset:n})),Te(+!o||1/0))))}function Ln(e,t,{target$:r}){let[o,n]=Array.from(e.children);return C(()=>{let i=new g,a=i.pipe(X(),ne(!0));return i.subscribe({next({offset:s}){e.style.setProperty("--md-tooltip-x",`${s.x}px`),e.style.setProperty("--md-tooltip-y",`${s.y}px`)},complete(){e.style.removeProperty("--md-tooltip-x"),e.style.removeProperty("--md-tooltip-y")}}),tt(e).pipe(U(a)).subscribe(s=>{e.toggleAttribute("data-md-visible",s)}),S(i.pipe(b(({active:s})=>s)),i.pipe(_e(250),b(({active:s})=>!s))).subscribe({next({active:s}){s?e.prepend(o):o.remove()},complete(){e.prepend(o)}}),i.pipe(Le(16,me)).subscribe(({active:s})=>{o.classList.toggle("md-tooltip--active",s)}),i.pipe(ct(125,me),b(()=>!!e.offsetParent),m(()=>e.offsetParent.getBoundingClientRect()),m(({x:s})=>s)).subscribe({next(s){s?e.style.setProperty("--md-tooltip-0",`${-s}px`):e.style.removeProperty("--md-tooltip-0")},complete(){e.style.removeProperty("--md-tooltip-0")}}),d(n,"click").pipe(U(a),b(s=>!(s.metaKey||s.ctrlKey))).subscribe(s=>{s.stopPropagation(),s.preventDefault()}),d(n,"mousedown").pipe(U(a),ee(i)).subscribe(([s,{active:p}])=>{var c;if(s.button!==0||s.metaKey||s.ctrlKey)s.preventDefault();else if(p){s.preventDefault();let l=e.parentElement.closest(".md-annotation");l instanceof HTMLElement?l.focus():(c=Re())==null||c.blur()}}),r.pipe(U(a),b(s=>s===o),Ge(125)).subscribe(()=>e.focus()),Pa(e,t).pipe(E(s=>i.next(s)),L(()=>i.complete()),m(s=>R({ref:e},s)))})}function Ra(e){return e.tagName==="CODE"?$(".c, .c1, .cm",e):[e]}function Ia(e){let t=[];for(let r of Ra(e)){let o=[],n=document.createNodeIterator(r,NodeFilter.SHOW_TEXT);for(let i=n.nextNode();i;i=n.nextNode())o.push(i);for(let i of o){let a;for(;a=/(\(\d+\))(!)?/.exec(i.textContent);){let[,s,p]=a;if(typeof p=="undefined"){let c=i.splitText(a.index);i=c.splitText(s.length),t.push(c)}else{i.textContent=s,t.push(i);break}}}}return t}function _n(e,t){t.append(...Array.from(e.childNodes))}function fr(e,t,{target$:r,print$:o}){let n=t.closest("[id]"),i=n==null?void 0:n.id,a=new Map;for(let s of Ia(t)){let[,p]=s.textContent.match(/\((\d+)\)/);fe(`:scope > li:nth-child(${p})`,e)&&(a.set(p,En(p,i)),s.replaceWith(a.get(p)))}return a.size===0?O:C(()=>{let s=new g,p=s.pipe(X(),ne(!0)),c=[];for(let[l,f]of a)c.push([P(".md-typeset",f),P(`:scope > li:nth-child(${l})`,e)]);return o.pipe(U(p)).subscribe(l=>{e.hidden=!l,e.classList.toggle("md-annotation-list",l);for(let[f,u]of c)l?_n(f,u):_n(u,f)}),S(...[...a].map(([,l])=>Ln(l,t,{target$:r}))).pipe(L(()=>s.complete()),pe())})}function An(e){if(e.nextElementSibling){let t=e.nextElementSibling;if(t.tagName==="OL")return t;if(t.tagName==="P"&&!t.children.length)return An(t)}}function Cn(e,t){return C(()=>{let r=An(e);return typeof r!="undefined"?fr(r,e,t):O})}var Hn=Vt(Yr());var Fa=0;function kn(e){if(e.nextElementSibling){let t=e.nextElementSibling;if(t.tagName==="OL")return t;if(t.tagName==="P"&&!t.children.length)return kn(t)}}function ja(e){return ge(e).pipe(m(({width:t})=>({scrollable:Tt(e).width>t})),Z("scrollable"))}function $n(e,t){let{matches:r}=matchMedia("(hover)"),o=C(()=>{let n=new g,i=n.pipe(Fr(1));n.subscribe(({scrollable:c})=>{c&&r?e.setAttribute("tabindex","0"):e.removeAttribute("tabindex")});let a=[];if(Hn.default.isSupported()&&(e.closest(".copy")||B("content.code.copy")&&!e.closest(".no-copy"))){let c=e.closest("pre");c.id=`__code_${Fa++}`;let l=wn(c.id);c.insertBefore(l,e),B("content.tooltips")&&a.push(lt(l,{viewport$}))}let s=e.closest(".highlight");if(s instanceof HTMLElement){let c=kn(s);if(typeof c!="undefined"&&(s.classList.contains("annotate")||B("content.code.annotate"))){let l=fr(c,e,t);a.push(ge(s).pipe(U(i),m(({width:f,height:u})=>f&&u),K(),v(f=>f?l:O)))}}return $(":scope > span[id]",e).length&&e.classList.add("md-code__content"),ja(e).pipe(E(c=>n.next(c)),L(()=>n.complete()),m(c=>R({ref:e},c)),Pe(...a))});return B("content.lazy")?tt(e).pipe(b(n=>n),Te(1),v(()=>o)):o}function Wa(e,{target$:t,print$:r}){let o=!0;return S(t.pipe(m(n=>n.closest("details:not([open])")),b(n=>e===n),m(()=>({action:"open",reveal:!0}))),r.pipe(b(n=>n||!o),E(()=>o=e.open),m(n=>({action:n?"open":"close"}))))}function Pn(e,t){return C(()=>{let r=new g;return r.subscribe(({action:o,reveal:n})=>{e.toggleAttribute("open",o==="open"),n&&e.scrollIntoView()}),Wa(e,t).pipe(E(o=>r.next(o)),L(()=>r.complete()),m(o=>R({ref:e},o)))})}var Rn=".node circle,.node ellipse,.node path,.node polygon,.node rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}marker{fill:var(--md-mermaid-edge-color)!important}.edgeLabel .label rect{fill:#0000}.label{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.label foreignObject{line-height:normal;overflow:visible}.label div .edgeLabel{color:var(--md-mermaid-label-fg-color)}.edgeLabel,.edgeLabel rect,.label div .edgeLabel{background-color:var(--md-mermaid-label-bg-color)}.edgeLabel,.edgeLabel rect{fill:var(--md-mermaid-label-bg-color);color:var(--md-mermaid-edge-color)}.edgePath .path,.flowchart-link{stroke:var(--md-mermaid-edge-color);stroke-width:.05rem}.edgePath .arrowheadPath{fill:var(--md-mermaid-edge-color);stroke:none}.cluster rect{fill:var(--md-default-fg-color--lightest);stroke:var(--md-default-fg-color--lighter)}.cluster span{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}g #flowchart-circleEnd,g #flowchart-circleStart,g #flowchart-crossEnd,g #flowchart-crossStart,g #flowchart-pointEnd,g #flowchart-pointStart{stroke:none}g.classGroup line,g.classGroup rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}g.classGroup text{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.classLabel .box{fill:var(--md-mermaid-label-bg-color);background-color:var(--md-mermaid-label-bg-color);opacity:1}.classLabel .label{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.node .divider{stroke:var(--md-mermaid-node-fg-color)}.relation{stroke:var(--md-mermaid-edge-color)}.cardinality{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.cardinality text{fill:inherit!important}defs #classDiagram-compositionEnd,defs #classDiagram-compositionStart,defs #classDiagram-dependencyEnd,defs #classDiagram-dependencyStart,defs #classDiagram-extensionEnd,defs #classDiagram-extensionStart{fill:var(--md-mermaid-edge-color)!important;stroke:var(--md-mermaid-edge-color)!important}defs #classDiagram-aggregationEnd,defs #classDiagram-aggregationStart{fill:var(--md-mermaid-label-bg-color)!important;stroke:var(--md-mermaid-edge-color)!important}g.stateGroup rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}g.stateGroup .state-title{fill:var(--md-mermaid-label-fg-color)!important;font-family:var(--md-mermaid-font-family)}g.stateGroup .composit{fill:var(--md-mermaid-label-bg-color)}.nodeLabel,.nodeLabel p{color:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}a .nodeLabel{text-decoration:underline}.node circle.state-end,.node circle.state-start,.start-state{fill:var(--md-mermaid-edge-color);stroke:none}.end-state-inner,.end-state-outer{fill:var(--md-mermaid-edge-color)}.end-state-inner,.node circle.state-end{stroke:var(--md-mermaid-label-bg-color)}.transition{stroke:var(--md-mermaid-edge-color)}[id^=state-fork] rect,[id^=state-join] rect{fill:var(--md-mermaid-edge-color)!important;stroke:none!important}.statediagram-cluster.statediagram-cluster .inner{fill:var(--md-default-bg-color)}.statediagram-cluster rect{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}.statediagram-state rect.divider{fill:var(--md-default-fg-color--lightest);stroke:var(--md-default-fg-color--lighter)}defs #statediagram-barbEnd{stroke:var(--md-mermaid-edge-color)}.attributeBoxEven,.attributeBoxOdd{fill:var(--md-mermaid-node-bg-color);stroke:var(--md-mermaid-node-fg-color)}.entityBox{fill:var(--md-mermaid-label-bg-color);stroke:var(--md-mermaid-node-fg-color)}.entityLabel{fill:var(--md-mermaid-label-fg-color);font-family:var(--md-mermaid-font-family)}.relationshipLabelBox{fill:var(--md-mermaid-label-bg-color);fill-opacity:1;background-color:var(--md-mermaid-label-bg-color);opacity:1}.relationshipLabel{fill:var(--md-mermaid-label-fg-color)}.relationshipLine{stroke:var(--md-mermaid-edge-color)}defs #ONE_OR_MORE_END *,defs #ONE_OR_MORE_START *,defs #ONLY_ONE_END *,defs #ONLY_ONE_START *,defs #ZERO_OR_MORE_END *,defs #ZERO_OR_MORE_START *,defs #ZERO_OR_ONE_END *,defs #ZERO_OR_ONE_START *{stroke:var(--md-mermaid-edge-color)!important}defs #ZERO_OR_MORE_END circle,defs #ZERO_OR_MORE_START circle{fill:var(--md-mermaid-label-bg-color)}.actor{fill:var(--md-mermaid-sequence-actor-bg-color);stroke:var(--md-mermaid-sequence-actor-border-color)}text.actor>tspan{fill:var(--md-mermaid-sequence-actor-fg-color);font-family:var(--md-mermaid-font-family)}line{stroke:var(--md-mermaid-sequence-actor-line-color)}.actor-man circle,.actor-man line{fill:var(--md-mermaid-sequence-actorman-bg-color);stroke:var(--md-mermaid-sequence-actorman-line-color)}.messageLine0,.messageLine1{stroke:var(--md-mermaid-sequence-message-line-color)}.note{fill:var(--md-mermaid-sequence-note-bg-color);stroke:var(--md-mermaid-sequence-note-border-color)}.loopText,.loopText>tspan,.messageText,.noteText>tspan{stroke:none;font-family:var(--md-mermaid-font-family)!important}.messageText{fill:var(--md-mermaid-sequence-message-fg-color)}.loopText,.loopText>tspan{fill:var(--md-mermaid-sequence-loop-fg-color)}.noteText>tspan{fill:var(--md-mermaid-sequence-note-fg-color)}#arrowhead path{fill:var(--md-mermaid-sequence-message-line-color);stroke:none}.loopLine{fill:var(--md-mermaid-sequence-loop-bg-color);stroke:var(--md-mermaid-sequence-loop-border-color)}.labelBox{fill:var(--md-mermaid-sequence-label-bg-color);stroke:none}.labelText,.labelText>span{fill:var(--md-mermaid-sequence-label-fg-color);font-family:var(--md-mermaid-font-family)}.sequenceNumber{fill:var(--md-mermaid-sequence-number-fg-color)}rect.rect{fill:var(--md-mermaid-sequence-box-bg-color);stroke:none}rect.rect+text.text{fill:var(--md-mermaid-sequence-box-fg-color)}defs #sequencenumber{fill:var(--md-mermaid-sequence-number-bg-color)!important}";var Br,Da=0;function Va(){return typeof mermaid=="undefined"||mermaid instanceof Element?wt("https://unpkg.com/mermaid@10/dist/mermaid.min.js"):I(void 0)}function In(e){return e.classList.remove("mermaid"),Br||(Br=Va().pipe(E(()=>mermaid.initialize({startOnLoad:!1,themeCSS:Rn,sequence:{actorFontSize:"16px",messageFontSize:"16px",noteFontSize:"16px"}})),m(()=>{}),G(1))),Br.subscribe(()=>ao(this,null,function*(){e.classList.add("mermaid");let t=`__mermaid_${Da++}`,r=x("div",{class:"mermaid"}),o=e.textContent,{svg:n,fn:i}=yield mermaid.render(t,o),a=r.attachShadow({mode:"closed"});a.innerHTML=n,e.replaceWith(r),i==null||i(a)})),Br.pipe(m(()=>({ref:e})))}var Fn=x("table");function jn(e){return e.replaceWith(Fn),Fn.replaceWith(On(e)),I({ref:e})}function Na(e){let t=e.find(r=>r.checked)||e[0];return S(...e.map(r=>d(r,"change").pipe(m(()=>P(`label[for="${r.id}"]`))))).pipe(Q(P(`label[for="${t.id}"]`)),m(r=>({active:r})))}function Wn(e,{viewport$:t,target$:r}){let o=P(".tabbed-labels",e),n=$(":scope > input",e),i=Qr("prev");e.append(i);let a=Qr("next");return e.append(a),C(()=>{let s=new g,p=s.pipe(X(),ne(!0));z([s,ge(e),tt(e)]).pipe(U(p),Le(1,me)).subscribe({next([{active:c},l]){let f=Ue(c),{width:u}=ce(c);e.style.setProperty("--md-indicator-x",`${f.x}px`),e.style.setProperty("--md-indicator-width",`${u}px`);let h=pr(o);(f.xh.x+l.width)&&o.scrollTo({left:Math.max(0,f.x-16),behavior:"smooth"})},complete(){e.style.removeProperty("--md-indicator-x"),e.style.removeProperty("--md-indicator-width")}}),z([De(o),ge(o)]).pipe(U(p)).subscribe(([c,l])=>{let f=Tt(o);i.hidden=c.x<16,a.hidden=c.x>f.width-l.width-16}),S(d(i,"click").pipe(m(()=>-1)),d(a,"click").pipe(m(()=>1))).pipe(U(p)).subscribe(c=>{let{width:l}=ce(o);o.scrollBy({left:l*c,behavior:"smooth"})}),r.pipe(U(p),b(c=>n.includes(c))).subscribe(c=>c.click()),o.classList.add("tabbed-labels--linked");for(let c of n){let l=P(`label[for="${c.id}"]`);l.replaceChildren(x("a",{href:`#${l.htmlFor}`,tabIndex:-1},...Array.from(l.childNodes))),d(l.firstElementChild,"click").pipe(U(p),b(f=>!(f.metaKey||f.ctrlKey)),E(f=>{f.preventDefault(),f.stopPropagation()})).subscribe(()=>{history.replaceState({},"",`#${l.htmlFor}`),l.click()})}return B("content.tabs.link")&&s.pipe(Ce(1),ee(t)).subscribe(([{active:c},{offset:l}])=>{let f=c.innerText.trim();if(c.hasAttribute("data-md-switching"))c.removeAttribute("data-md-switching");else{let u=e.offsetTop-l.y;for(let w of $("[data-tabs]"))for(let A of $(":scope > input",w)){let te=P(`label[for="${A.id}"]`);if(te!==c&&te.innerText.trim()===f){te.setAttribute("data-md-switching",""),A.click();break}}window.scrollTo({top:e.offsetTop-u});let h=__md_get("__tabs")||[];__md_set("__tabs",[...new Set([f,...h])])}}),s.pipe(U(p)).subscribe(()=>{for(let c of $("audio, video",e))c.pause()}),Na(n).pipe(E(c=>s.next(c)),L(()=>s.complete()),m(c=>R({ref:e},c)))}).pipe(Qe(se))}function Un(e,{viewport$:t,target$:r,print$:o}){return S(...$(".annotate:not(.highlight)",e).map(n=>Cn(n,{target$:r,print$:o})),...$("pre:not(.mermaid) > code",e).map(n=>$n(n,{target$:r,print$:o})),...$("pre.mermaid",e).map(n=>In(n)),...$("table:not([class])",e).map(n=>jn(n)),...$("details",e).map(n=>Pn(n,{target$:r,print$:o})),...$("[data-tabs]",e).map(n=>Wn(n,{viewport$:t,target$:r})),...$("[title]",e).filter(()=>B("content.tooltips")).map(n=>lt(n,{viewport$:t})))}function za(e,{alert$:t}){return t.pipe(v(r=>S(I(!0),I(!1).pipe(Ge(2e3))).pipe(m(o=>({message:r,active:o})))))}function Dn(e,t){let r=P(".md-typeset",e);return C(()=>{let o=new g;return o.subscribe(({message:n,active:i})=>{e.classList.toggle("md-dialog--active",i),r.textContent=n}),za(e,t).pipe(E(n=>o.next(n)),L(()=>o.complete()),m(n=>R({ref:e},n)))})}var qa=0;function Qa(e,t){document.body.append(e);let{width:r}=ce(e);e.style.setProperty("--md-tooltip-width",`${r}px`),e.remove();let o=cr(t),n=typeof o!="undefined"?De(o):I({x:0,y:0}),i=S(et(t),kt(t)).pipe(K());return z([i,n]).pipe(m(([a,s])=>{let{x:p,y:c}=Ue(t),l=ce(t),f=t.closest("table");return f&&t.parentElement&&(p+=f.offsetLeft+t.parentElement.offsetLeft,c+=f.offsetTop+t.parentElement.offsetTop),{active:a,offset:{x:p-s.x+l.width/2-r/2,y:c-s.y+l.height+8}}}))}function Vn(e){let t=e.title;if(!t.length)return O;let r=`__tooltip_${qa++}`,o=Pt(r,"inline"),n=P(".md-typeset",o);return n.innerHTML=t,C(()=>{let i=new g;return i.subscribe({next({offset:a}){o.style.setProperty("--md-tooltip-x",`${a.x}px`),o.style.setProperty("--md-tooltip-y",`${a.y}px`)},complete(){o.style.removeProperty("--md-tooltip-x"),o.style.removeProperty("--md-tooltip-y")}}),S(i.pipe(b(({active:a})=>a)),i.pipe(_e(250),b(({active:a})=>!a))).subscribe({next({active:a}){a?(e.insertAdjacentElement("afterend",o),e.setAttribute("aria-describedby",r),e.removeAttribute("title")):(o.remove(),e.removeAttribute("aria-describedby"),e.setAttribute("title",t))},complete(){o.remove(),e.removeAttribute("aria-describedby"),e.setAttribute("title",t)}}),i.pipe(Le(16,me)).subscribe(({active:a})=>{o.classList.toggle("md-tooltip--active",a)}),i.pipe(ct(125,me),b(()=>!!e.offsetParent),m(()=>e.offsetParent.getBoundingClientRect()),m(({x:a})=>a)).subscribe({next(a){a?o.style.setProperty("--md-tooltip-0",`${-a}px`):o.style.removeProperty("--md-tooltip-0")},complete(){o.style.removeProperty("--md-tooltip-0")}}),Qa(o,e).pipe(E(a=>i.next(a)),L(()=>i.complete()),m(a=>R({ref:e},a)))}).pipe(Qe(se))}function Ka({viewport$:e}){if(!B("header.autohide"))return I(!1);let t=e.pipe(m(({offset:{y:n}})=>n),Ye(2,1),m(([n,i])=>[nMath.abs(i-n.y)>100),m(([,[n]])=>n),K()),o=Ve("search");return z([e,o]).pipe(m(([{offset:n},i])=>n.y>400&&!i),K(),v(n=>n?r:I(!1)),Q(!1))}function Nn(e,t){return C(()=>z([ge(e),Ka(t)])).pipe(m(([{height:r},o])=>({height:r,hidden:o})),K((r,o)=>r.height===o.height&&r.hidden===o.hidden),G(1))}function zn(e,{header$:t,main$:r}){return C(()=>{let o=new g,n=o.pipe(X(),ne(!0));o.pipe(Z("active"),We(t)).subscribe(([{active:a},{hidden:s}])=>{e.classList.toggle("md-header--shadow",a&&!s),e.hidden=s});let i=ue($("[title]",e)).pipe(b(()=>B("content.tooltips")),oe(a=>Vn(a)));return r.subscribe(o),t.pipe(U(n),m(a=>R({ref:e},a)),Pe(i.pipe(U(n))))})}function Ya(e,{viewport$:t,header$:r}){return mr(e,{viewport$:t,header$:r}).pipe(m(({offset:{y:o}})=>{let{height:n}=ce(e);return{active:o>=n}}),Z("active"))}function qn(e,t){return C(()=>{let r=new g;r.subscribe({next({active:n}){e.classList.toggle("md-header__title--active",n)},complete(){e.classList.remove("md-header__title--active")}});let o=fe(".md-content h1");return typeof o=="undefined"?O:Ya(o,t).pipe(E(n=>r.next(n)),L(()=>r.complete()),m(n=>R({ref:e},n)))})}function Qn(e,{viewport$:t,header$:r}){let o=r.pipe(m(({height:i})=>i),K()),n=o.pipe(v(()=>ge(e).pipe(m(({height:i})=>({top:e.offsetTop,bottom:e.offsetTop+i})),Z("bottom"))));return z([o,n,t]).pipe(m(([i,{top:a,bottom:s},{offset:{y:p},size:{height:c}}])=>(c=Math.max(0,c-Math.max(0,a-p,i)-Math.max(0,c+p-s)),{offset:a-i,height:c,active:a-i<=p})),K((i,a)=>i.offset===a.offset&&i.height===a.height&&i.active===a.active))}function Ba(e){let t=__md_get("__palette")||{index:e.findIndex(o=>matchMedia(o.getAttribute("data-md-color-media")).matches)},r=Math.max(0,Math.min(t.index,e.length-1));return I(...e).pipe(oe(o=>d(o,"change").pipe(m(()=>o))),Q(e[r]),m(o=>({index:e.indexOf(o),color:{media:o.getAttribute("data-md-color-media"),scheme:o.getAttribute("data-md-color-scheme"),primary:o.getAttribute("data-md-color-primary"),accent:o.getAttribute("data-md-color-accent")}})),G(1))}function Kn(e){let t=$("input",e),r=x("meta",{name:"theme-color"});document.head.appendChild(r);let o=x("meta",{name:"color-scheme"});document.head.appendChild(o);let n=$t("(prefers-color-scheme: light)");return C(()=>{let i=new g;return i.subscribe(a=>{if(document.body.setAttribute("data-md-color-switching",""),a.color.media==="(prefers-color-scheme)"){let s=matchMedia("(prefers-color-scheme: light)"),p=document.querySelector(s.matches?"[data-md-color-media='(prefers-color-scheme: light)']":"[data-md-color-media='(prefers-color-scheme: dark)']");a.color.scheme=p.getAttribute("data-md-color-scheme"),a.color.primary=p.getAttribute("data-md-color-primary"),a.color.accent=p.getAttribute("data-md-color-accent")}for(let[s,p]of Object.entries(a.color))document.body.setAttribute(`data-md-color-${s}`,p);for(let s=0;sa.key==="Enter"),ee(i,(a,s)=>s)).subscribe(({index:a})=>{a=(a+1)%t.length,t[a].click(),t[a].focus()}),i.pipe(m(()=>{let a=Se("header"),s=window.getComputedStyle(a);return o.content=s.colorScheme,s.backgroundColor.match(/\d+/g).map(p=>(+p).toString(16).padStart(2,"0")).join("")})).subscribe(a=>r.content=`#${a}`),i.pipe(be(se)).subscribe(()=>{document.body.removeAttribute("data-md-color-switching")}),Ba(t).pipe(U(n.pipe(Ce(1))),st(),E(a=>i.next(a)),L(()=>i.complete()),m(a=>R({ref:e},a)))})}function Yn(e,{progress$:t}){return C(()=>{let r=new g;return r.subscribe(({value:o})=>{e.style.setProperty("--md-progress-value",`${o}`)}),t.pipe(E(o=>r.next({value:o})),L(()=>r.complete()),m(o=>({ref:e,value:o})))})}var Gr=Vt(Yr());function Ga(e){e.setAttribute("data-md-copying","");let t=e.closest("[data-copy]"),r=t?t.getAttribute("data-copy"):e.innerText;return e.removeAttribute("data-md-copying"),r.trimEnd()}function Bn({alert$:e}){Gr.default.isSupported()&&new F(t=>{new Gr.default("[data-clipboard-target], [data-clipboard-text]",{text:r=>r.getAttribute("data-clipboard-text")||Ga(P(r.getAttribute("data-clipboard-target")))}).on("success",r=>t.next(r))}).pipe(E(t=>{t.trigger.focus()}),m(()=>Ee("clipboard.copied"))).subscribe(e)}function Gn(e,t){return e.protocol=t.protocol,e.hostname=t.hostname,e}function Ja(e,t){let r=new Map;for(let o of $("url",e)){let n=P("loc",o),i=[Gn(new URL(n.textContent),t)];r.set(`${i[0]}`,i);for(let a of $("[rel=alternate]",o)){let s=a.getAttribute("href");s!=null&&i.push(Gn(new URL(s),t))}}return r}function ur(e){return mn(new URL("sitemap.xml",e)).pipe(m(t=>Ja(t,new URL(e))),ve(()=>I(new Map)))}function Xa(e,t){if(!(e.target instanceof Element))return O;let r=e.target.closest("a");if(r===null)return O;if(r.target||e.metaKey||e.ctrlKey)return O;let o=new URL(r.href);return o.search=o.hash="",t.has(`${o}`)?(e.preventDefault(),I(new URL(r.href))):O}function Jn(e){let t=new Map;for(let r of $(":scope > *",e.head))t.set(r.outerHTML,r);return t}function Xn(e){for(let t of $("[href], [src]",e))for(let r of["href","src"]){let o=t.getAttribute(r);if(o&&!/^(?:[a-z]+:)?\/\//i.test(o)){t[r]=t[r];break}}return I(e)}function Za(e){for(let o of["[data-md-component=announce]","[data-md-component=container]","[data-md-component=header-topic]","[data-md-component=outdated]","[data-md-component=logo]","[data-md-component=skip]",...B("navigation.tabs.sticky")?["[data-md-component=tabs]"]:[]]){let n=fe(o),i=fe(o,e);typeof n!="undefined"&&typeof i!="undefined"&&n.replaceWith(i)}let t=Jn(document);for(let[o,n]of Jn(e))t.has(o)?t.delete(o):document.head.appendChild(n);for(let o of t.values()){let n=o.getAttribute("name");n!=="theme-color"&&n!=="color-scheme"&&o.remove()}let r=Se("container");return je($("script",r)).pipe(v(o=>{let n=e.createElement("script");if(o.src){for(let i of o.getAttributeNames())n.setAttribute(i,o.getAttribute(i));return o.replaceWith(n),new F(i=>{n.onload=()=>i.complete()})}else return n.textContent=o.textContent,o.replaceWith(n),O}),X(),ne(document))}function Zn({location$:e,viewport$:t,progress$:r}){let o=ye();if(location.protocol==="file:")return O;let n=ur(o.base);I(document).subscribe(Xn);let i=d(document.body,"click").pipe(We(n),v(([p,c])=>Xa(p,c)),pe()),a=d(window,"popstate").pipe(m(xe),pe());i.pipe(ee(t)).subscribe(([p,{offset:c}])=>{history.replaceState(c,""),history.pushState(null,"",p)}),S(i,a).subscribe(e);let s=e.pipe(Z("pathname"),v(p=>ln(p,{progress$:r}).pipe(ve(()=>(pt(p,!0),O)))),v(Xn),v(Za),pe());return S(s.pipe(ee(e,(p,c)=>c)),s.pipe(v(()=>e),Z("pathname"),v(()=>e),Z("hash")),e.pipe(K((p,c)=>p.pathname===c.pathname&&p.hash===c.hash),v(()=>i),E(()=>history.back()))).subscribe(p=>{var c,l;history.state!==null||!p.hash?window.scrollTo(0,(l=(c=history.state)==null?void 0:c.y)!=null?l:0):(history.scrollRestoration="auto",sn(p.hash),history.scrollRestoration="manual")}),e.subscribe(()=>{history.scrollRestoration="manual"}),d(window,"beforeunload").subscribe(()=>{history.scrollRestoration="auto"}),t.pipe(Z("offset"),_e(100)).subscribe(({offset:p})=>{history.replaceState(p,"")}),s}var ri=Vt(ti());function oi(e){let t=e.separator.split("|").map(n=>n.replace(/(\(\?[!=<][^)]+\))/g,"").length===0?"\uFFFD":n).join("|"),r=new RegExp(t,"img"),o=(n,i,a)=>`${i}${a}`;return n=>{n=n.replace(/[\s*+\-:~^]+/g," ").trim();let i=new RegExp(`(^|${e.separator}|)(${n.replace(/[|\\{}()[\]^$+*?.-]/g,"\\$&").replace(r,"|")})`,"img");return a=>(0,ri.default)(a).replace(i,o).replace(/<\/mark>(\s+)]*>/img,"$1")}}function It(e){return e.type===1}function dr(e){return e.type===3}function ni(e,t){let r=vn(e);return S(I(location.protocol!=="file:"),Ve("search")).pipe(Ae(o=>o),v(()=>t)).subscribe(({config:o,docs:n})=>r.next({type:0,data:{config:o,docs:n,options:{suggest:B("search.suggest")}}})),r}function ii({document$:e}){let t=ye(),r=Ne(new URL("../versions.json",t.base)).pipe(ve(()=>O)),o=r.pipe(m(n=>{let[,i]=t.base.match(/([^/]+)\/?$/);return n.find(({version:a,aliases:s})=>a===i||s.includes(i))||n[0]}));r.pipe(m(n=>new Map(n.map(i=>[`${new URL(`../${i.version}/`,t.base)}`,i]))),v(n=>d(document.body,"click").pipe(b(i=>!i.metaKey&&!i.ctrlKey),ee(o),v(([i,a])=>{if(i.target instanceof Element){let s=i.target.closest("a");if(s&&!s.target&&n.has(s.href)){let p=s.href;return!i.target.closest(".md-version")&&n.get(p)===a?O:(i.preventDefault(),I(p))}}return O}),v(i=>ur(new URL(i)).pipe(m(a=>{let p=xe().href.replace(t.base,i);return a.has(p.split("#")[0])?new URL(p):new URL(i)})))))).subscribe(n=>pt(n,!0)),z([r,o]).subscribe(([n,i])=>{P(".md-header__topic").appendChild(Mn(n,i))}),e.pipe(v(()=>o)).subscribe(n=>{var a;let i=__md_get("__outdated",sessionStorage);if(i===null){i=!0;let s=((a=t.version)==null?void 0:a.default)||"latest";Array.isArray(s)||(s=[s]);e:for(let p of s)for(let c of n.aliases.concat(n.version))if(new RegExp(p,"i").test(c)){i=!1;break e}__md_set("__outdated",i,sessionStorage)}if(i)for(let s of ae("outdated"))s.hidden=!1})}function ns(e,{worker$:t}){let{searchParams:r}=xe();r.has("q")&&(Je("search",!0),e.value=r.get("q"),e.focus(),Ve("search").pipe(Ae(i=>!i)).subscribe(()=>{let i=xe();i.searchParams.delete("q"),history.replaceState({},"",`${i}`)}));let o=et(e),n=S(t.pipe(Ae(It)),d(e,"keyup"),o).pipe(m(()=>e.value),K());return z([n,o]).pipe(m(([i,a])=>({value:i,focus:a})),G(1))}function ai(e,{worker$:t}){let r=new g,o=r.pipe(X(),ne(!0));z([t.pipe(Ae(It)),r],(i,a)=>a).pipe(Z("value")).subscribe(({value:i})=>t.next({type:2,data:i})),r.pipe(Z("focus")).subscribe(({focus:i})=>{i&&Je("search",i)}),d(e.form,"reset").pipe(U(o)).subscribe(()=>e.focus());let n=P("header [for=__search]");return d(n,"click").subscribe(()=>e.focus()),ns(e,{worker$:t}).pipe(E(i=>r.next(i)),L(()=>r.complete()),m(i=>R({ref:e},i)),G(1))}function si(e,{worker$:t,query$:r}){let o=new g,n=tn(e.parentElement).pipe(b(Boolean)),i=e.parentElement,a=P(":scope > :first-child",e),s=P(":scope > :last-child",e);Ve("search").subscribe(l=>s.setAttribute("role",l?"list":"presentation")),o.pipe(ee(r),Ur(t.pipe(Ae(It)))).subscribe(([{items:l},{value:f}])=>{switch(l.length){case 0:a.textContent=f.length?Ee("search.result.none"):Ee("search.result.placeholder");break;case 1:a.textContent=Ee("search.result.one");break;default:let u=sr(l.length);a.textContent=Ee("search.result.other",u)}});let p=o.pipe(E(()=>s.innerHTML=""),v(({items:l})=>S(I(...l.slice(0,10)),I(...l.slice(10)).pipe(Ye(4),Vr(n),v(([f])=>f)))),m(Tn),pe());return p.subscribe(l=>s.appendChild(l)),p.pipe(oe(l=>{let f=fe("details",l);return typeof f=="undefined"?O:d(f,"toggle").pipe(U(o),m(()=>f))})).subscribe(l=>{l.open===!1&&l.offsetTop<=i.scrollTop&&i.scrollTo({top:l.offsetTop})}),t.pipe(b(dr),m(({data:l})=>l)).pipe(E(l=>o.next(l)),L(()=>o.complete()),m(l=>R({ref:e},l)))}function is(e,{query$:t}){return t.pipe(m(({value:r})=>{let o=xe();return o.hash="",r=r.replace(/\s+/g,"+").replace(/&/g,"%26").replace(/=/g,"%3D"),o.search=`q=${r}`,{url:o}}))}function ci(e,t){let r=new g,o=r.pipe(X(),ne(!0));return r.subscribe(({url:n})=>{e.setAttribute("data-clipboard-text",e.href),e.href=`${n}`}),d(e,"click").pipe(U(o)).subscribe(n=>n.preventDefault()),is(e,t).pipe(E(n=>r.next(n)),L(()=>r.complete()),m(n=>R({ref:e},n)))}function pi(e,{worker$:t,keyboard$:r}){let o=new g,n=Se("search-query"),i=S(d(n,"keydown"),d(n,"focus")).pipe(be(se),m(()=>n.value),K());return o.pipe(We(i),m(([{suggest:s},p])=>{let c=p.split(/([\s-]+)/);if(s!=null&&s.length&&c[c.length-1]){let l=s[s.length-1];l.startsWith(c[c.length-1])&&(c[c.length-1]=l)}else c.length=0;return c})).subscribe(s=>e.innerHTML=s.join("").replace(/\s/g," ")),r.pipe(b(({mode:s})=>s==="search")).subscribe(s=>{switch(s.type){case"ArrowRight":e.innerText.length&&n.selectionStart===n.value.length&&(n.value=e.innerText);break}}),t.pipe(b(dr),m(({data:s})=>s)).pipe(E(s=>o.next(s)),L(()=>o.complete()),m(()=>({ref:e})))}function li(e,{index$:t,keyboard$:r}){let o=ye();try{let n=ni(o.search,t),i=Se("search-query",e),a=Se("search-result",e);d(e,"click").pipe(b(({target:p})=>p instanceof Element&&!!p.closest("a"))).subscribe(()=>Je("search",!1)),r.pipe(b(({mode:p})=>p==="search")).subscribe(p=>{let c=Re();switch(p.type){case"Enter":if(c===i){let l=new Map;for(let f of $(":first-child [href]",a)){let u=f.firstElementChild;l.set(f,parseFloat(u.getAttribute("data-md-score")))}if(l.size){let[[f]]=[...l].sort(([,u],[,h])=>h-u);f.click()}p.claim()}break;case"Escape":case"Tab":Je("search",!1),i.blur();break;case"ArrowUp":case"ArrowDown":if(typeof c=="undefined")i.focus();else{let l=[i,...$(":not(details) > [href], summary, details[open] [href]",a)],f=Math.max(0,(Math.max(0,l.indexOf(c))+l.length+(p.type==="ArrowUp"?-1:1))%l.length);l[f].focus()}p.claim();break;default:i!==Re()&&i.focus()}}),r.pipe(b(({mode:p})=>p==="global")).subscribe(p=>{switch(p.type){case"f":case"s":case"/":i.focus(),i.select(),p.claim();break}});let s=ai(i,{worker$:n});return S(s,si(a,{worker$:n,query$:s})).pipe(Pe(...ae("search-share",e).map(p=>ci(p,{query$:s})),...ae("search-suggest",e).map(p=>pi(p,{worker$:n,keyboard$:r}))))}catch(n){return e.hidden=!0,Ke}}function mi(e,{index$:t,location$:r}){return z([t,r.pipe(Q(xe()),b(o=>!!o.searchParams.get("h")))]).pipe(m(([o,n])=>oi(o.config)(n.searchParams.get("h"))),m(o=>{var a;let n=new Map,i=document.createNodeIterator(e,NodeFilter.SHOW_TEXT);for(let s=i.nextNode();s;s=i.nextNode())if((a=s.parentElement)!=null&&a.offsetHeight){let p=s.textContent,c=o(p);c.length>p.length&&n.set(s,c)}for(let[s,p]of n){let{childNodes:c}=x("span",null,p);s.replaceWith(...Array.from(c))}return{ref:e,nodes:n}}))}function as(e,{viewport$:t,main$:r}){let o=e.closest(".md-grid"),n=o.offsetTop-o.parentElement.offsetTop;return z([r,t]).pipe(m(([{offset:i,height:a},{offset:{y:s}}])=>(a=a+Math.min(n,Math.max(0,s-i))-n,{height:a,locked:s>=i+n})),K((i,a)=>i.height===a.height&&i.locked===a.locked))}function Jr(e,o){var n=o,{header$:t}=n,r=io(n,["header$"]);let i=P(".md-sidebar__scrollwrap",e),{y:a}=Ue(i);return C(()=>{let s=new g,p=s.pipe(X(),ne(!0)),c=s.pipe(Le(0,me));return c.pipe(ee(t)).subscribe({next([{height:l},{height:f}]){i.style.height=`${l-2*a}px`,e.style.top=`${f}px`},complete(){i.style.height="",e.style.top=""}}),c.pipe(Ae()).subscribe(()=>{for(let l of $(".md-nav__link--active[href]",e)){if(!l.clientHeight)continue;let f=l.closest(".md-sidebar__scrollwrap");if(typeof f!="undefined"){let u=l.offsetTop-f.offsetTop,{height:h}=ce(f);f.scrollTo({top:u-h/2})}}}),ue($("label[tabindex]",e)).pipe(oe(l=>d(l,"click").pipe(be(se),m(()=>l),U(p)))).subscribe(l=>{let f=P(`[id="${l.htmlFor}"]`);P(`[aria-labelledby="${l.id}"]`).setAttribute("aria-expanded",`${f.checked}`)}),as(e,r).pipe(E(l=>s.next(l)),L(()=>s.complete()),m(l=>R({ref:e},l)))})}function fi(e,t){if(typeof t!="undefined"){let r=`https://api.github.com/repos/${e}/${t}`;return Ct(Ne(`${r}/releases/latest`).pipe(ve(()=>O),m(o=>({version:o.tag_name})),Be({})),Ne(r).pipe(ve(()=>O),m(o=>({stars:o.stargazers_count,forks:o.forks_count})),Be({}))).pipe(m(([o,n])=>R(R({},o),n)))}else{let r=`https://api.github.com/users/${e}`;return Ne(r).pipe(m(o=>({repositories:o.public_repos})),Be({}))}}function ui(e,t){let r=`https://${e}/api/v4/projects/${encodeURIComponent(t)}`;return Ne(r).pipe(ve(()=>O),m(({star_count:o,forks_count:n})=>({stars:o,forks:n})),Be({}))}function di(e){let t=e.match(/^.+github\.com\/([^/]+)\/?([^/]+)?/i);if(t){let[,r,o]=t;return fi(r,o)}if(t=e.match(/^.+?([^/]*gitlab[^/]+)\/(.+?)\/?$/i),t){let[,r,o]=t;return ui(r,o)}return O}var ss;function cs(e){return ss||(ss=C(()=>{let t=__md_get("__source",sessionStorage);if(t)return I(t);if(ae("consent").length){let o=__md_get("__consent");if(!(o&&o.github))return O}return di(e.href).pipe(E(o=>__md_set("__source",o,sessionStorage)))}).pipe(ve(()=>O),b(t=>Object.keys(t).length>0),m(t=>({facts:t})),G(1)))}function hi(e){let t=P(":scope > :last-child",e);return C(()=>{let r=new g;return r.subscribe(({facts:o})=>{t.appendChild(Sn(o)),t.classList.add("md-source__repository--active")}),cs(e).pipe(E(o=>r.next(o)),L(()=>r.complete()),m(o=>R({ref:e},o)))})}function ps(e,{viewport$:t,header$:r}){return ge(document.body).pipe(v(()=>mr(e,{header$:r,viewport$:t})),m(({offset:{y:o}})=>({hidden:o>=10})),Z("hidden"))}function bi(e,t){return C(()=>{let r=new g;return r.subscribe({next({hidden:o}){e.hidden=o},complete(){e.hidden=!1}}),(B("navigation.tabs.sticky")?I({hidden:!1}):ps(e,t)).pipe(E(o=>r.next(o)),L(()=>r.complete()),m(o=>R({ref:e},o)))})}function ls(e,{viewport$:t,header$:r}){let o=new Map,n=$(".md-nav__link",e);for(let s of n){let p=decodeURIComponent(s.hash.substring(1)),c=fe(`[id="${p}"]`);typeof c!="undefined"&&o.set(s,c)}let i=r.pipe(Z("height"),m(({height:s})=>{let p=Se("main"),c=P(":scope > :first-child",p);return s+.8*(c.offsetTop-p.offsetTop)}),pe());return ge(document.body).pipe(Z("height"),v(s=>C(()=>{let p=[];return I([...o].reduce((c,[l,f])=>{for(;p.length&&o.get(p[p.length-1]).tagName>=f.tagName;)p.pop();let u=f.offsetTop;for(;!u&&f.parentElement;)f=f.parentElement,u=f.offsetTop;let h=f.offsetParent;for(;h;h=h.offsetParent)u+=h.offsetTop;return c.set([...p=[...p,l]].reverse(),u)},new Map))}).pipe(m(p=>new Map([...p].sort(([,c],[,l])=>c-l))),We(i),v(([p,c])=>t.pipe(jr(([l,f],{offset:{y:u},size:h})=>{let w=u+h.height>=Math.floor(s.height);for(;f.length;){let[,A]=f[0];if(A-c=u&&!w)f=[l.pop(),...f];else break}return[l,f]},[[],[...p]]),K((l,f)=>l[0]===f[0]&&l[1]===f[1])))))).pipe(m(([s,p])=>({prev:s.map(([c])=>c),next:p.map(([c])=>c)})),Q({prev:[],next:[]}),Ye(2,1),m(([s,p])=>s.prev.length{let i=new g,a=i.pipe(X(),ne(!0));if(i.subscribe(({prev:s,next:p})=>{for(let[c]of p)c.classList.remove("md-nav__link--passed"),c.classList.remove("md-nav__link--active");for(let[c,[l]]of s.entries())l.classList.add("md-nav__link--passed"),l.classList.toggle("md-nav__link--active",c===s.length-1)}),B("toc.follow")){let s=S(t.pipe(_e(1),m(()=>{})),t.pipe(_e(250),m(()=>"smooth")));i.pipe(b(({prev:p})=>p.length>0),We(o.pipe(be(se))),ee(s)).subscribe(([[{prev:p}],c])=>{let[l]=p[p.length-1];if(l.offsetHeight){let f=cr(l);if(typeof f!="undefined"){let u=l.offsetTop-f.offsetTop,{height:h}=ce(f);f.scrollTo({top:u-h/2,behavior:c})}}})}return B("navigation.tracking")&&t.pipe(U(a),Z("offset"),_e(250),Ce(1),U(n.pipe(Ce(1))),st({delay:250}),ee(i)).subscribe(([,{prev:s}])=>{let p=xe(),c=s[s.length-1];if(c&&c.length){let[l]=c,{hash:f}=new URL(l.href);p.hash!==f&&(p.hash=f,history.replaceState({},"",`${p}`))}else p.hash="",history.replaceState({},"",`${p}`)}),ls(e,{viewport$:t,header$:r}).pipe(E(s=>i.next(s)),L(()=>i.complete()),m(s=>R({ref:e},s)))})}function ms(e,{viewport$:t,main$:r,target$:o}){let n=t.pipe(m(({offset:{y:a}})=>a),Ye(2,1),m(([a,s])=>a>s&&s>0),K()),i=r.pipe(m(({active:a})=>a));return z([i,n]).pipe(m(([a,s])=>!(a&&s)),K(),U(o.pipe(Ce(1))),ne(!0),st({delay:250}),m(a=>({hidden:a})))}function gi(e,{viewport$:t,header$:r,main$:o,target$:n}){let i=new g,a=i.pipe(X(),ne(!0));return i.subscribe({next({hidden:s}){e.hidden=s,s?(e.setAttribute("tabindex","-1"),e.blur()):e.removeAttribute("tabindex")},complete(){e.style.top="",e.hidden=!0,e.removeAttribute("tabindex")}}),r.pipe(U(a),Z("height")).subscribe(({height:s})=>{e.style.top=`${s+16}px`}),d(e,"click").subscribe(s=>{s.preventDefault(),window.scrollTo({top:0})}),ms(e,{viewport$:t,main$:o,target$:n}).pipe(E(s=>i.next(s)),L(()=>i.complete()),m(s=>R({ref:e},s)))}function xi({document$:e,viewport$:t}){e.pipe(v(()=>$(".md-ellipsis")),oe(r=>tt(r).pipe(U(e.pipe(Ce(1))),b(o=>o),m(()=>r),Te(1))),b(r=>r.offsetWidth{let o=r.innerText,n=r.closest("a")||r;return n.title=o,B("content.tooltips")?lt(n,{viewport$:t}).pipe(U(e.pipe(Ce(1))),L(()=>n.removeAttribute("title"))):O})).subscribe(),B("content.tooltips")&&e.pipe(v(()=>$(".md-status")),oe(r=>lt(r,{viewport$:t}))).subscribe()}function yi({document$:e,tablet$:t}){e.pipe(v(()=>$(".md-toggle--indeterminate")),E(r=>{r.indeterminate=!0,r.checked=!1}),oe(r=>d(r,"change").pipe(Dr(()=>r.classList.contains("md-toggle--indeterminate")),m(()=>r))),ee(t)).subscribe(([r,o])=>{r.classList.remove("md-toggle--indeterminate"),o&&(r.checked=!1)})}function fs(){return/(iPad|iPhone|iPod)/.test(navigator.userAgent)}function Ei({document$:e}){e.pipe(v(()=>$("[data-md-scrollfix]")),E(t=>t.removeAttribute("data-md-scrollfix")),b(fs),oe(t=>d(t,"touchstart").pipe(m(()=>t)))).subscribe(t=>{let r=t.scrollTop;r===0?t.scrollTop=1:r+t.offsetHeight===t.scrollHeight&&(t.scrollTop=r-1)})}function wi({viewport$:e,tablet$:t}){z([Ve("search"),t]).pipe(m(([r,o])=>r&&!o),v(r=>I(r).pipe(Ge(r?400:100))),ee(e)).subscribe(([r,{offset:{y:o}}])=>{if(r)document.body.setAttribute("data-md-scrolllock",""),document.body.style.top=`-${o}px`;else{let n=-1*parseInt(document.body.style.top,10);document.body.removeAttribute("data-md-scrolllock"),document.body.style.top="",n&&window.scrollTo(0,n)}})}Object.entries||(Object.entries=function(e){let t=[];for(let r of Object.keys(e))t.push([r,e[r]]);return t});Object.values||(Object.values=function(e){let t=[];for(let r of Object.keys(e))t.push(e[r]);return t});typeof Element!="undefined"&&(Element.prototype.scrollTo||(Element.prototype.scrollTo=function(e,t){typeof e=="object"?(this.scrollLeft=e.left,this.scrollTop=e.top):(this.scrollLeft=e,this.scrollTop=t)}),Element.prototype.replaceWith||(Element.prototype.replaceWith=function(...e){let t=this.parentNode;if(t){e.length===0&&t.removeChild(this);for(let r=e.length-1;r>=0;r--){let o=e[r];typeof o=="string"?o=document.createTextNode(o):o.parentNode&&o.parentNode.removeChild(o),r?t.insertBefore(this.previousSibling,o):t.replaceChild(o,this)}}}));function us(){return location.protocol==="file:"?wt(`${new URL("search/search_index.js",Xr.base)}`).pipe(m(()=>__index),G(1)):Ne(new URL("search/search_index.json",Xr.base))}document.documentElement.classList.remove("no-js");document.documentElement.classList.add("js");var ot=Yo(),jt=nn(),Ot=cn(jt),Zr=on(),Oe=bn(),hr=$t("(min-width: 960px)"),Si=$t("(min-width: 1220px)"),Oi=pn(),Xr=ye(),Mi=document.forms.namedItem("search")?us():Ke,eo=new g;Bn({alert$:eo});var to=new g;B("navigation.instant")&&Zn({location$:jt,viewport$:Oe,progress$:to}).subscribe(ot);var Ti;((Ti=Xr.version)==null?void 0:Ti.provider)==="mike"&&ii({document$:ot});S(jt,Ot).pipe(Ge(125)).subscribe(()=>{Je("drawer",!1),Je("search",!1)});Zr.pipe(b(({mode:e})=>e==="global")).subscribe(e=>{switch(e.type){case"p":case",":let t=fe("link[rel=prev]");typeof t!="undefined"&&pt(t);break;case"n":case".":let r=fe("link[rel=next]");typeof r!="undefined"&&pt(r);break;case"Enter":let o=Re();o instanceof HTMLLabelElement&&o.click()}});xi({viewport$:Oe,document$:ot});yi({document$:ot,tablet$:hr});Ei({document$:ot});wi({viewport$:Oe,tablet$:hr});var rt=Nn(Se("header"),{viewport$:Oe}),Ft=ot.pipe(m(()=>Se("main")),v(e=>Qn(e,{viewport$:Oe,header$:rt})),G(1)),ds=S(...ae("consent").map(e=>xn(e,{target$:Ot})),...ae("dialog").map(e=>Dn(e,{alert$:eo})),...ae("header").map(e=>zn(e,{viewport$:Oe,header$:rt,main$:Ft})),...ae("palette").map(e=>Kn(e)),...ae("progress").map(e=>Yn(e,{progress$:to})),...ae("search").map(e=>li(e,{index$:Mi,keyboard$:Zr})),...ae("source").map(e=>hi(e))),hs=C(()=>S(...ae("announce").map(e=>gn(e)),...ae("content").map(e=>Un(e,{viewport$:Oe,target$:Ot,print$:Oi})),...ae("content").map(e=>B("search.highlight")?mi(e,{index$:Mi,location$:jt}):O),...ae("header-title").map(e=>qn(e,{viewport$:Oe,header$:rt})),...ae("sidebar").map(e=>e.getAttribute("data-md-type")==="navigation"?Nr(Si,()=>Jr(e,{viewport$:Oe,header$:rt,main$:Ft})):Nr(hr,()=>Jr(e,{viewport$:Oe,header$:rt,main$:Ft}))),...ae("tabs").map(e=>bi(e,{viewport$:Oe,header$:rt})),...ae("toc").map(e=>vi(e,{viewport$:Oe,header$:rt,main$:Ft,target$:Ot})),...ae("top").map(e=>gi(e,{viewport$:Oe,header$:rt,main$:Ft,target$:Ot})))),Li=ot.pipe(v(()=>hs),Pe(ds),G(1));Li.subscribe();window.document$=ot;window.location$=jt;window.target$=Ot;window.keyboard$=Zr;window.viewport$=Oe;window.tablet$=hr;window.screen$=Si;window.print$=Oi;window.alert$=eo;window.progress$=to;window.component$=Li;})(); +//# sourceMappingURL=bundle.fe8b6f2b.min.js.map + diff --git a/assets/javascripts/bundle.fe8b6f2b.min.js.map b/assets/javascripts/bundle.fe8b6f2b.min.js.map new file mode 100644 index 0000000..8263585 --- /dev/null +++ b/assets/javascripts/bundle.fe8b6f2b.min.js.map @@ -0,0 +1,7 @@ +{ + "version": 3, + "sources": ["node_modules/focus-visible/dist/focus-visible.js", "node_modules/clipboard/dist/clipboard.js", "node_modules/escape-html/index.js", "src/templates/assets/javascripts/bundle.ts", "node_modules/rxjs/node_modules/tslib/tslib.es6.js", "node_modules/rxjs/src/internal/util/isFunction.ts", "node_modules/rxjs/src/internal/util/createErrorClass.ts", "node_modules/rxjs/src/internal/util/UnsubscriptionError.ts", "node_modules/rxjs/src/internal/util/arrRemove.ts", "node_modules/rxjs/src/internal/Subscription.ts", "node_modules/rxjs/src/internal/config.ts", "node_modules/rxjs/src/internal/scheduler/timeoutProvider.ts", "node_modules/rxjs/src/internal/util/reportUnhandledError.ts", "node_modules/rxjs/src/internal/util/noop.ts", "node_modules/rxjs/src/internal/NotificationFactories.ts", "node_modules/rxjs/src/internal/util/errorContext.ts", "node_modules/rxjs/src/internal/Subscriber.ts", "node_modules/rxjs/src/internal/symbol/observable.ts", "node_modules/rxjs/src/internal/util/identity.ts", "node_modules/rxjs/src/internal/util/pipe.ts", "node_modules/rxjs/src/internal/Observable.ts", "node_modules/rxjs/src/internal/util/lift.ts", "node_modules/rxjs/src/internal/operators/OperatorSubscriber.ts", "node_modules/rxjs/src/internal/scheduler/animationFrameProvider.ts", "node_modules/rxjs/src/internal/util/ObjectUnsubscribedError.ts", "node_modules/rxjs/src/internal/Subject.ts", "node_modules/rxjs/src/internal/BehaviorSubject.ts", "node_modules/rxjs/src/internal/scheduler/dateTimestampProvider.ts", "node_modules/rxjs/src/internal/ReplaySubject.ts", "node_modules/rxjs/src/internal/scheduler/Action.ts", "node_modules/rxjs/src/internal/scheduler/intervalProvider.ts", "node_modules/rxjs/src/internal/scheduler/AsyncAction.ts", "node_modules/rxjs/src/internal/Scheduler.ts", "node_modules/rxjs/src/internal/scheduler/AsyncScheduler.ts", "node_modules/rxjs/src/internal/scheduler/async.ts", "node_modules/rxjs/src/internal/scheduler/QueueAction.ts", "node_modules/rxjs/src/internal/scheduler/QueueScheduler.ts", "node_modules/rxjs/src/internal/scheduler/queue.ts", "node_modules/rxjs/src/internal/scheduler/AnimationFrameAction.ts", "node_modules/rxjs/src/internal/scheduler/AnimationFrameScheduler.ts", "node_modules/rxjs/src/internal/scheduler/animationFrame.ts", "node_modules/rxjs/src/internal/observable/empty.ts", "node_modules/rxjs/src/internal/util/isScheduler.ts", "node_modules/rxjs/src/internal/util/args.ts", "node_modules/rxjs/src/internal/util/isArrayLike.ts", "node_modules/rxjs/src/internal/util/isPromise.ts", "node_modules/rxjs/src/internal/util/isInteropObservable.ts", "node_modules/rxjs/src/internal/util/isAsyncIterable.ts", "node_modules/rxjs/src/internal/util/throwUnobservableError.ts", "node_modules/rxjs/src/internal/symbol/iterator.ts", "node_modules/rxjs/src/internal/util/isIterable.ts", "node_modules/rxjs/src/internal/util/isReadableStreamLike.ts", "node_modules/rxjs/src/internal/observable/innerFrom.ts", "node_modules/rxjs/src/internal/util/executeSchedule.ts", "node_modules/rxjs/src/internal/operators/observeOn.ts", "node_modules/rxjs/src/internal/operators/subscribeOn.ts", "node_modules/rxjs/src/internal/scheduled/scheduleObservable.ts", "node_modules/rxjs/src/internal/scheduled/schedulePromise.ts", "node_modules/rxjs/src/internal/scheduled/scheduleArray.ts", "node_modules/rxjs/src/internal/scheduled/scheduleIterable.ts", "node_modules/rxjs/src/internal/scheduled/scheduleAsyncIterable.ts", "node_modules/rxjs/src/internal/scheduled/scheduleReadableStreamLike.ts", "node_modules/rxjs/src/internal/scheduled/scheduled.ts", "node_modules/rxjs/src/internal/observable/from.ts", "node_modules/rxjs/src/internal/observable/of.ts", "node_modules/rxjs/src/internal/observable/throwError.ts", "node_modules/rxjs/src/internal/util/EmptyError.ts", "node_modules/rxjs/src/internal/util/isDate.ts", "node_modules/rxjs/src/internal/operators/map.ts", "node_modules/rxjs/src/internal/util/mapOneOrManyArgs.ts", "node_modules/rxjs/src/internal/util/argsArgArrayOrObject.ts", "node_modules/rxjs/src/internal/util/createObject.ts", "node_modules/rxjs/src/internal/observable/combineLatest.ts", "node_modules/rxjs/src/internal/operators/mergeInternals.ts", "node_modules/rxjs/src/internal/operators/mergeMap.ts", "node_modules/rxjs/src/internal/operators/mergeAll.ts", "node_modules/rxjs/src/internal/operators/concatAll.ts", "node_modules/rxjs/src/internal/observable/concat.ts", "node_modules/rxjs/src/internal/observable/defer.ts", "node_modules/rxjs/src/internal/observable/fromEvent.ts", "node_modules/rxjs/src/internal/observable/fromEventPattern.ts", "node_modules/rxjs/src/internal/observable/timer.ts", "node_modules/rxjs/src/internal/observable/merge.ts", "node_modules/rxjs/src/internal/observable/never.ts", "node_modules/rxjs/src/internal/util/argsOrArgArray.ts", "node_modules/rxjs/src/internal/operators/filter.ts", "node_modules/rxjs/src/internal/observable/zip.ts", "node_modules/rxjs/src/internal/operators/audit.ts", "node_modules/rxjs/src/internal/operators/auditTime.ts", "node_modules/rxjs/src/internal/operators/bufferCount.ts", "node_modules/rxjs/src/internal/operators/catchError.ts", "node_modules/rxjs/src/internal/operators/scanInternals.ts", "node_modules/rxjs/src/internal/operators/combineLatest.ts", "node_modules/rxjs/src/internal/operators/combineLatestWith.ts", "node_modules/rxjs/src/internal/operators/debounce.ts", "node_modules/rxjs/src/internal/operators/debounceTime.ts", "node_modules/rxjs/src/internal/operators/defaultIfEmpty.ts", "node_modules/rxjs/src/internal/operators/take.ts", "node_modules/rxjs/src/internal/operators/ignoreElements.ts", "node_modules/rxjs/src/internal/operators/mapTo.ts", "node_modules/rxjs/src/internal/operators/delayWhen.ts", "node_modules/rxjs/src/internal/operators/delay.ts", "node_modules/rxjs/src/internal/operators/distinctUntilChanged.ts", "node_modules/rxjs/src/internal/operators/distinctUntilKeyChanged.ts", "node_modules/rxjs/src/internal/operators/throwIfEmpty.ts", "node_modules/rxjs/src/internal/operators/endWith.ts", "node_modules/rxjs/src/internal/operators/finalize.ts", "node_modules/rxjs/src/internal/operators/first.ts", "node_modules/rxjs/src/internal/operators/takeLast.ts", "node_modules/rxjs/src/internal/operators/merge.ts", "node_modules/rxjs/src/internal/operators/mergeWith.ts", "node_modules/rxjs/src/internal/operators/repeat.ts", "node_modules/rxjs/src/internal/operators/scan.ts", "node_modules/rxjs/src/internal/operators/share.ts", "node_modules/rxjs/src/internal/operators/shareReplay.ts", "node_modules/rxjs/src/internal/operators/skip.ts", "node_modules/rxjs/src/internal/operators/skipUntil.ts", "node_modules/rxjs/src/internal/operators/startWith.ts", "node_modules/rxjs/src/internal/operators/switchMap.ts", "node_modules/rxjs/src/internal/operators/takeUntil.ts", "node_modules/rxjs/src/internal/operators/takeWhile.ts", "node_modules/rxjs/src/internal/operators/tap.ts", "node_modules/rxjs/src/internal/operators/throttle.ts", "node_modules/rxjs/src/internal/operators/throttleTime.ts", "node_modules/rxjs/src/internal/operators/withLatestFrom.ts", "node_modules/rxjs/src/internal/operators/zip.ts", "node_modules/rxjs/src/internal/operators/zipWith.ts", "src/templates/assets/javascripts/browser/document/index.ts", "src/templates/assets/javascripts/browser/element/_/index.ts", "src/templates/assets/javascripts/browser/element/focus/index.ts", "src/templates/assets/javascripts/browser/element/hover/index.ts", "src/templates/assets/javascripts/utilities/h/index.ts", "src/templates/assets/javascripts/utilities/round/index.ts", "src/templates/assets/javascripts/browser/script/index.ts", "src/templates/assets/javascripts/browser/element/size/_/index.ts", "src/templates/assets/javascripts/browser/element/size/content/index.ts", "src/templates/assets/javascripts/browser/element/offset/_/index.ts", "src/templates/assets/javascripts/browser/element/offset/content/index.ts", "src/templates/assets/javascripts/browser/element/visibility/index.ts", "src/templates/assets/javascripts/browser/toggle/index.ts", "src/templates/assets/javascripts/browser/keyboard/index.ts", "src/templates/assets/javascripts/browser/location/_/index.ts", "src/templates/assets/javascripts/browser/location/hash/index.ts", "src/templates/assets/javascripts/browser/media/index.ts", "src/templates/assets/javascripts/browser/request/index.ts", "src/templates/assets/javascripts/browser/viewport/offset/index.ts", "src/templates/assets/javascripts/browser/viewport/size/index.ts", "src/templates/assets/javascripts/browser/viewport/_/index.ts", "src/templates/assets/javascripts/browser/viewport/at/index.ts", "src/templates/assets/javascripts/browser/worker/index.ts", "src/templates/assets/javascripts/_/index.ts", "src/templates/assets/javascripts/components/_/index.ts", "src/templates/assets/javascripts/components/announce/index.ts", "src/templates/assets/javascripts/components/consent/index.ts", "src/templates/assets/javascripts/templates/tooltip/index.tsx", "src/templates/assets/javascripts/templates/annotation/index.tsx", "src/templates/assets/javascripts/templates/clipboard/index.tsx", "src/templates/assets/javascripts/templates/search/index.tsx", "src/templates/assets/javascripts/templates/source/index.tsx", "src/templates/assets/javascripts/templates/tabbed/index.tsx", "src/templates/assets/javascripts/templates/table/index.tsx", "src/templates/assets/javascripts/templates/version/index.tsx", "src/templates/assets/javascripts/components/tooltip2/index.ts", "src/templates/assets/javascripts/components/content/annotation/_/index.ts", "src/templates/assets/javascripts/components/content/annotation/list/index.ts", "src/templates/assets/javascripts/components/content/annotation/block/index.ts", "src/templates/assets/javascripts/components/content/code/_/index.ts", "src/templates/assets/javascripts/components/content/details/index.ts", "src/templates/assets/javascripts/components/content/mermaid/index.css", "src/templates/assets/javascripts/components/content/mermaid/index.ts", "src/templates/assets/javascripts/components/content/table/index.ts", "src/templates/assets/javascripts/components/content/tabs/index.ts", "src/templates/assets/javascripts/components/content/_/index.ts", "src/templates/assets/javascripts/components/dialog/index.ts", "src/templates/assets/javascripts/components/tooltip/index.ts", "src/templates/assets/javascripts/components/header/_/index.ts", "src/templates/assets/javascripts/components/header/title/index.ts", "src/templates/assets/javascripts/components/main/index.ts", "src/templates/assets/javascripts/components/palette/index.ts", "src/templates/assets/javascripts/components/progress/index.ts", "src/templates/assets/javascripts/integrations/clipboard/index.ts", "src/templates/assets/javascripts/integrations/sitemap/index.ts", "src/templates/assets/javascripts/integrations/instant/index.ts", "src/templates/assets/javascripts/integrations/search/highlighter/index.ts", "src/templates/assets/javascripts/integrations/search/worker/message/index.ts", "src/templates/assets/javascripts/integrations/search/worker/_/index.ts", "src/templates/assets/javascripts/integrations/version/index.ts", "src/templates/assets/javascripts/components/search/query/index.ts", "src/templates/assets/javascripts/components/search/result/index.ts", "src/templates/assets/javascripts/components/search/share/index.ts", "src/templates/assets/javascripts/components/search/suggest/index.ts", "src/templates/assets/javascripts/components/search/_/index.ts", "src/templates/assets/javascripts/components/search/highlight/index.ts", "src/templates/assets/javascripts/components/sidebar/index.ts", "src/templates/assets/javascripts/components/source/facts/github/index.ts", "src/templates/assets/javascripts/components/source/facts/gitlab/index.ts", "src/templates/assets/javascripts/components/source/facts/_/index.ts", "src/templates/assets/javascripts/components/source/_/index.ts", "src/templates/assets/javascripts/components/tabs/index.ts", "src/templates/assets/javascripts/components/toc/index.ts", "src/templates/assets/javascripts/components/top/index.ts", "src/templates/assets/javascripts/patches/ellipsis/index.ts", "src/templates/assets/javascripts/patches/indeterminate/index.ts", "src/templates/assets/javascripts/patches/scrollfix/index.ts", "src/templates/assets/javascripts/patches/scrolllock/index.ts", "src/templates/assets/javascripts/polyfills/index.ts"], + "sourcesContent": ["(function (global, factory) {\n typeof exports === 'object' && typeof module !== 'undefined' ? factory() :\n typeof define === 'function' && define.amd ? define(factory) :\n (factory());\n}(this, (function () { 'use strict';\n\n /**\n * Applies the :focus-visible polyfill at the given scope.\n * A scope in this case is either the top-level Document or a Shadow Root.\n *\n * @param {(Document|ShadowRoot)} scope\n * @see https://github.com/WICG/focus-visible\n */\n function applyFocusVisiblePolyfill(scope) {\n var hadKeyboardEvent = true;\n var hadFocusVisibleRecently = false;\n var hadFocusVisibleRecentlyTimeout = null;\n\n var inputTypesAllowlist = {\n text: true,\n search: true,\n url: true,\n tel: true,\n email: true,\n password: true,\n number: true,\n date: true,\n month: true,\n week: true,\n time: true,\n datetime: true,\n 'datetime-local': true\n };\n\n /**\n * Helper function for legacy browsers and iframes which sometimes focus\n * elements like document, body, and non-interactive SVG.\n * @param {Element} el\n */\n function isValidFocusTarget(el) {\n if (\n el &&\n el !== document &&\n el.nodeName !== 'HTML' &&\n el.nodeName !== 'BODY' &&\n 'classList' in el &&\n 'contains' in el.classList\n ) {\n return true;\n }\n return false;\n }\n\n /**\n * Computes whether the given element should automatically trigger the\n * `focus-visible` class being added, i.e. whether it should always match\n * `:focus-visible` when focused.\n * @param {Element} el\n * @return {boolean}\n */\n function focusTriggersKeyboardModality(el) {\n var type = el.type;\n var tagName = el.tagName;\n\n if (tagName === 'INPUT' && inputTypesAllowlist[type] && !el.readOnly) {\n return true;\n }\n\n if (tagName === 'TEXTAREA' && !el.readOnly) {\n return true;\n }\n\n if (el.isContentEditable) {\n return true;\n }\n\n return false;\n }\n\n /**\n * Add the `focus-visible` class to the given element if it was not added by\n * the author.\n * @param {Element} el\n */\n function addFocusVisibleClass(el) {\n if (el.classList.contains('focus-visible')) {\n return;\n }\n el.classList.add('focus-visible');\n el.setAttribute('data-focus-visible-added', '');\n }\n\n /**\n * Remove the `focus-visible` class from the given element if it was not\n * originally added by the author.\n * @param {Element} el\n */\n function removeFocusVisibleClass(el) {\n if (!el.hasAttribute('data-focus-visible-added')) {\n return;\n }\n el.classList.remove('focus-visible');\n el.removeAttribute('data-focus-visible-added');\n }\n\n /**\n * If the most recent user interaction was via the keyboard;\n * and the key press did not include a meta, alt/option, or control key;\n * then the modality is keyboard. Otherwise, the modality is not keyboard.\n * Apply `focus-visible` to any current active element and keep track\n * of our keyboard modality state with `hadKeyboardEvent`.\n * @param {KeyboardEvent} e\n */\n function onKeyDown(e) {\n if (e.metaKey || e.altKey || e.ctrlKey) {\n return;\n }\n\n if (isValidFocusTarget(scope.activeElement)) {\n addFocusVisibleClass(scope.activeElement);\n }\n\n hadKeyboardEvent = true;\n }\n\n /**\n * If at any point a user clicks with a pointing device, ensure that we change\n * the modality away from keyboard.\n * This avoids the situation where a user presses a key on an already focused\n * element, and then clicks on a different element, focusing it with a\n * pointing device, while we still think we're in keyboard modality.\n * @param {Event} e\n */\n function onPointerDown(e) {\n hadKeyboardEvent = false;\n }\n\n /**\n * On `focus`, add the `focus-visible` class to the target if:\n * - the target received focus as a result of keyboard navigation, or\n * - the event target is an element that will likely require interaction\n * via the keyboard (e.g. a text box)\n * @param {Event} e\n */\n function onFocus(e) {\n // Prevent IE from focusing the document or HTML element.\n if (!isValidFocusTarget(e.target)) {\n return;\n }\n\n if (hadKeyboardEvent || focusTriggersKeyboardModality(e.target)) {\n addFocusVisibleClass(e.target);\n }\n }\n\n /**\n * On `blur`, remove the `focus-visible` class from the target.\n * @param {Event} e\n */\n function onBlur(e) {\n if (!isValidFocusTarget(e.target)) {\n return;\n }\n\n if (\n e.target.classList.contains('focus-visible') ||\n e.target.hasAttribute('data-focus-visible-added')\n ) {\n // To detect a tab/window switch, we look for a blur event followed\n // rapidly by a visibility change.\n // If we don't see a visibility change within 100ms, it's probably a\n // regular focus change.\n hadFocusVisibleRecently = true;\n window.clearTimeout(hadFocusVisibleRecentlyTimeout);\n hadFocusVisibleRecentlyTimeout = window.setTimeout(function() {\n hadFocusVisibleRecently = false;\n }, 100);\n removeFocusVisibleClass(e.target);\n }\n }\n\n /**\n * If the user changes tabs, keep track of whether or not the previously\n * focused element had .focus-visible.\n * @param {Event} e\n */\n function onVisibilityChange(e) {\n if (document.visibilityState === 'hidden') {\n // If the tab becomes active again, the browser will handle calling focus\n // on the element (Safari actually calls it twice).\n // If this tab change caused a blur on an element with focus-visible,\n // re-apply the class when the user switches back to the tab.\n if (hadFocusVisibleRecently) {\n hadKeyboardEvent = true;\n }\n addInitialPointerMoveListeners();\n }\n }\n\n /**\n * Add a group of listeners to detect usage of any pointing devices.\n * These listeners will be added when the polyfill first loads, and anytime\n * the window is blurred, so that they are active when the window regains\n * focus.\n */\n function addInitialPointerMoveListeners() {\n document.addEventListener('mousemove', onInitialPointerMove);\n document.addEventListener('mousedown', onInitialPointerMove);\n document.addEventListener('mouseup', onInitialPointerMove);\n document.addEventListener('pointermove', onInitialPointerMove);\n document.addEventListener('pointerdown', onInitialPointerMove);\n document.addEventListener('pointerup', onInitialPointerMove);\n document.addEventListener('touchmove', onInitialPointerMove);\n document.addEventListener('touchstart', onInitialPointerMove);\n document.addEventListener('touchend', onInitialPointerMove);\n }\n\n function removeInitialPointerMoveListeners() {\n document.removeEventListener('mousemove', onInitialPointerMove);\n document.removeEventListener('mousedown', onInitialPointerMove);\n document.removeEventListener('mouseup', onInitialPointerMove);\n document.removeEventListener('pointermove', onInitialPointerMove);\n document.removeEventListener('pointerdown', onInitialPointerMove);\n document.removeEventListener('pointerup', onInitialPointerMove);\n document.removeEventListener('touchmove', onInitialPointerMove);\n document.removeEventListener('touchstart', onInitialPointerMove);\n document.removeEventListener('touchend', onInitialPointerMove);\n }\n\n /**\n * When the polfyill first loads, assume the user is in keyboard modality.\n * If any event is received from a pointing device (e.g. mouse, pointer,\n * touch), turn off keyboard modality.\n * This accounts for situations where focus enters the page from the URL bar.\n * @param {Event} e\n */\n function onInitialPointerMove(e) {\n // Work around a Safari quirk that fires a mousemove on whenever the\n // window blurs, even if you're tabbing out of the page. \u00AF\\_(\u30C4)_/\u00AF\n if (e.target.nodeName && e.target.nodeName.toLowerCase() === 'html') {\n return;\n }\n\n hadKeyboardEvent = false;\n removeInitialPointerMoveListeners();\n }\n\n // For some kinds of state, we are interested in changes at the global scope\n // only. For example, global pointer input, global key presses and global\n // visibility change should affect the state at every scope:\n document.addEventListener('keydown', onKeyDown, true);\n document.addEventListener('mousedown', onPointerDown, true);\n document.addEventListener('pointerdown', onPointerDown, true);\n document.addEventListener('touchstart', onPointerDown, true);\n document.addEventListener('visibilitychange', onVisibilityChange, true);\n\n addInitialPointerMoveListeners();\n\n // For focus and blur, we specifically care about state changes in the local\n // scope. This is because focus / blur events that originate from within a\n // shadow root are not re-dispatched from the host element if it was already\n // the active element in its own scope:\n scope.addEventListener('focus', onFocus, true);\n scope.addEventListener('blur', onBlur, true);\n\n // We detect that a node is a ShadowRoot by ensuring that it is a\n // DocumentFragment and also has a host property. This check covers native\n // implementation and polyfill implementation transparently. If we only cared\n // about the native implementation, we could just check if the scope was\n // an instance of a ShadowRoot.\n if (scope.nodeType === Node.DOCUMENT_FRAGMENT_NODE && scope.host) {\n // Since a ShadowRoot is a special kind of DocumentFragment, it does not\n // have a root element to add a class to. So, we add this attribute to the\n // host element instead:\n scope.host.setAttribute('data-js-focus-visible', '');\n } else if (scope.nodeType === Node.DOCUMENT_NODE) {\n document.documentElement.classList.add('js-focus-visible');\n document.documentElement.setAttribute('data-js-focus-visible', '');\n }\n }\n\n // It is important to wrap all references to global window and document in\n // these checks to support server-side rendering use cases\n // @see https://github.com/WICG/focus-visible/issues/199\n if (typeof window !== 'undefined' && typeof document !== 'undefined') {\n // Make the polyfill helper globally available. This can be used as a signal\n // to interested libraries that wish to coordinate with the polyfill for e.g.,\n // applying the polyfill to a shadow root:\n window.applyFocusVisiblePolyfill = applyFocusVisiblePolyfill;\n\n // Notify interested libraries of the polyfill's presence, in case the\n // polyfill was loaded lazily:\n var event;\n\n try {\n event = new CustomEvent('focus-visible-polyfill-ready');\n } catch (error) {\n // IE11 does not support using CustomEvent as a constructor directly:\n event = document.createEvent('CustomEvent');\n event.initCustomEvent('focus-visible-polyfill-ready', false, false, {});\n }\n\n window.dispatchEvent(event);\n }\n\n if (typeof document !== 'undefined') {\n // Apply the polyfill to the global document, so that no JavaScript\n // coordination is required to use the polyfill in the top-level document:\n applyFocusVisiblePolyfill(document);\n }\n\n})));\n", "/*!\n * clipboard.js v2.0.11\n * https://clipboardjs.com/\n *\n * Licensed MIT \u00A9 Zeno Rocha\n */\n(function webpackUniversalModuleDefinition(root, factory) {\n\tif(typeof exports === 'object' && typeof module === 'object')\n\t\tmodule.exports = factory();\n\telse if(typeof define === 'function' && define.amd)\n\t\tdefine([], factory);\n\telse if(typeof exports === 'object')\n\t\texports[\"ClipboardJS\"] = factory();\n\telse\n\t\troot[\"ClipboardJS\"] = factory();\n})(this, function() {\nreturn /******/ (function() { // webpackBootstrap\n/******/ \tvar __webpack_modules__ = ({\n\n/***/ 686:\n/***/ (function(__unused_webpack_module, __webpack_exports__, __webpack_require__) {\n\n\"use strict\";\n\n// EXPORTS\n__webpack_require__.d(__webpack_exports__, {\n \"default\": function() { return /* binding */ clipboard; }\n});\n\n// EXTERNAL MODULE: ./node_modules/tiny-emitter/index.js\nvar tiny_emitter = __webpack_require__(279);\nvar tiny_emitter_default = /*#__PURE__*/__webpack_require__.n(tiny_emitter);\n// EXTERNAL MODULE: ./node_modules/good-listener/src/listen.js\nvar listen = __webpack_require__(370);\nvar listen_default = /*#__PURE__*/__webpack_require__.n(listen);\n// EXTERNAL MODULE: ./node_modules/select/src/select.js\nvar src_select = __webpack_require__(817);\nvar select_default = /*#__PURE__*/__webpack_require__.n(src_select);\n;// CONCATENATED MODULE: ./src/common/command.js\n/**\n * Executes a given operation type.\n * @param {String} type\n * @return {Boolean}\n */\nfunction command(type) {\n try {\n return document.execCommand(type);\n } catch (err) {\n return false;\n }\n}\n;// CONCATENATED MODULE: ./src/actions/cut.js\n\n\n/**\n * Cut action wrapper.\n * @param {String|HTMLElement} target\n * @return {String}\n */\n\nvar ClipboardActionCut = function ClipboardActionCut(target) {\n var selectedText = select_default()(target);\n command('cut');\n return selectedText;\n};\n\n/* harmony default export */ var actions_cut = (ClipboardActionCut);\n;// CONCATENATED MODULE: ./src/common/create-fake-element.js\n/**\n * Creates a fake textarea element with a value.\n * @param {String} value\n * @return {HTMLElement}\n */\nfunction createFakeElement(value) {\n var isRTL = document.documentElement.getAttribute('dir') === 'rtl';\n var fakeElement = document.createElement('textarea'); // Prevent zooming on iOS\n\n fakeElement.style.fontSize = '12pt'; // Reset box model\n\n fakeElement.style.border = '0';\n fakeElement.style.padding = '0';\n fakeElement.style.margin = '0'; // Move element out of screen horizontally\n\n fakeElement.style.position = 'absolute';\n fakeElement.style[isRTL ? 'right' : 'left'] = '-9999px'; // Move element to the same position vertically\n\n var yPosition = window.pageYOffset || document.documentElement.scrollTop;\n fakeElement.style.top = \"\".concat(yPosition, \"px\");\n fakeElement.setAttribute('readonly', '');\n fakeElement.value = value;\n return fakeElement;\n}\n;// CONCATENATED MODULE: ./src/actions/copy.js\n\n\n\n/**\n * Create fake copy action wrapper using a fake element.\n * @param {String} target\n * @param {Object} options\n * @return {String}\n */\n\nvar fakeCopyAction = function fakeCopyAction(value, options) {\n var fakeElement = createFakeElement(value);\n options.container.appendChild(fakeElement);\n var selectedText = select_default()(fakeElement);\n command('copy');\n fakeElement.remove();\n return selectedText;\n};\n/**\n * Copy action wrapper.\n * @param {String|HTMLElement} target\n * @param {Object} options\n * @return {String}\n */\n\n\nvar ClipboardActionCopy = function ClipboardActionCopy(target) {\n var options = arguments.length > 1 && arguments[1] !== undefined ? arguments[1] : {\n container: document.body\n };\n var selectedText = '';\n\n if (typeof target === 'string') {\n selectedText = fakeCopyAction(target, options);\n } else if (target instanceof HTMLInputElement && !['text', 'search', 'url', 'tel', 'password'].includes(target === null || target === void 0 ? void 0 : target.type)) {\n // If input type doesn't support `setSelectionRange`. Simulate it. https://developer.mozilla.org/en-US/docs/Web/API/HTMLInputElement/setSelectionRange\n selectedText = fakeCopyAction(target.value, options);\n } else {\n selectedText = select_default()(target);\n command('copy');\n }\n\n return selectedText;\n};\n\n/* harmony default export */ var actions_copy = (ClipboardActionCopy);\n;// CONCATENATED MODULE: ./src/actions/default.js\nfunction _typeof(obj) { \"@babel/helpers - typeof\"; if (typeof Symbol === \"function\" && typeof Symbol.iterator === \"symbol\") { _typeof = function _typeof(obj) { return typeof obj; }; } else { _typeof = function _typeof(obj) { return obj && typeof Symbol === \"function\" && obj.constructor === Symbol && obj !== Symbol.prototype ? \"symbol\" : typeof obj; }; } return _typeof(obj); }\n\n\n\n/**\n * Inner function which performs selection from either `text` or `target`\n * properties and then executes copy or cut operations.\n * @param {Object} options\n */\n\nvar ClipboardActionDefault = function ClipboardActionDefault() {\n var options = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : {};\n // Defines base properties passed from constructor.\n var _options$action = options.action,\n action = _options$action === void 0 ? 'copy' : _options$action,\n container = options.container,\n target = options.target,\n text = options.text; // Sets the `action` to be performed which can be either 'copy' or 'cut'.\n\n if (action !== 'copy' && action !== 'cut') {\n throw new Error('Invalid \"action\" value, use either \"copy\" or \"cut\"');\n } // Sets the `target` property using an element that will be have its content copied.\n\n\n if (target !== undefined) {\n if (target && _typeof(target) === 'object' && target.nodeType === 1) {\n if (action === 'copy' && target.hasAttribute('disabled')) {\n throw new Error('Invalid \"target\" attribute. Please use \"readonly\" instead of \"disabled\" attribute');\n }\n\n if (action === 'cut' && (target.hasAttribute('readonly') || target.hasAttribute('disabled'))) {\n throw new Error('Invalid \"target\" attribute. You can\\'t cut text from elements with \"readonly\" or \"disabled\" attributes');\n }\n } else {\n throw new Error('Invalid \"target\" value, use a valid Element');\n }\n } // Define selection strategy based on `text` property.\n\n\n if (text) {\n return actions_copy(text, {\n container: container\n });\n } // Defines which selection strategy based on `target` property.\n\n\n if (target) {\n return action === 'cut' ? actions_cut(target) : actions_copy(target, {\n container: container\n });\n }\n};\n\n/* harmony default export */ var actions_default = (ClipboardActionDefault);\n;// CONCATENATED MODULE: ./src/clipboard.js\nfunction clipboard_typeof(obj) { \"@babel/helpers - typeof\"; if (typeof Symbol === \"function\" && typeof Symbol.iterator === \"symbol\") { clipboard_typeof = function _typeof(obj) { return typeof obj; }; } else { clipboard_typeof = function _typeof(obj) { return obj && typeof Symbol === \"function\" && obj.constructor === Symbol && obj !== Symbol.prototype ? \"symbol\" : typeof obj; }; } return clipboard_typeof(obj); }\n\nfunction _classCallCheck(instance, Constructor) { if (!(instance instanceof Constructor)) { throw new TypeError(\"Cannot call a class as a function\"); } }\n\nfunction _defineProperties(target, props) { for (var i = 0; i < props.length; i++) { var descriptor = props[i]; descriptor.enumerable = descriptor.enumerable || false; descriptor.configurable = true; if (\"value\" in descriptor) descriptor.writable = true; Object.defineProperty(target, descriptor.key, descriptor); } }\n\nfunction _createClass(Constructor, protoProps, staticProps) { if (protoProps) _defineProperties(Constructor.prototype, protoProps); if (staticProps) _defineProperties(Constructor, staticProps); return Constructor; }\n\nfunction _inherits(subClass, superClass) { if (typeof superClass !== \"function\" && superClass !== null) { throw new TypeError(\"Super expression must either be null or a function\"); } subClass.prototype = Object.create(superClass && superClass.prototype, { constructor: { value: subClass, writable: true, configurable: true } }); if (superClass) _setPrototypeOf(subClass, superClass); }\n\nfunction _setPrototypeOf(o, p) { _setPrototypeOf = Object.setPrototypeOf || function _setPrototypeOf(o, p) { o.__proto__ = p; return o; }; return _setPrototypeOf(o, p); }\n\nfunction _createSuper(Derived) { var hasNativeReflectConstruct = _isNativeReflectConstruct(); return function _createSuperInternal() { var Super = _getPrototypeOf(Derived), result; if (hasNativeReflectConstruct) { var NewTarget = _getPrototypeOf(this).constructor; result = Reflect.construct(Super, arguments, NewTarget); } else { result = Super.apply(this, arguments); } return _possibleConstructorReturn(this, result); }; }\n\nfunction _possibleConstructorReturn(self, call) { if (call && (clipboard_typeof(call) === \"object\" || typeof call === \"function\")) { return call; } return _assertThisInitialized(self); }\n\nfunction _assertThisInitialized(self) { if (self === void 0) { throw new ReferenceError(\"this hasn't been initialised - super() hasn't been called\"); } return self; }\n\nfunction _isNativeReflectConstruct() { if (typeof Reflect === \"undefined\" || !Reflect.construct) return false; if (Reflect.construct.sham) return false; if (typeof Proxy === \"function\") return true; try { Date.prototype.toString.call(Reflect.construct(Date, [], function () {})); return true; } catch (e) { return false; } }\n\nfunction _getPrototypeOf(o) { _getPrototypeOf = Object.setPrototypeOf ? Object.getPrototypeOf : function _getPrototypeOf(o) { return o.__proto__ || Object.getPrototypeOf(o); }; return _getPrototypeOf(o); }\n\n\n\n\n\n\n/**\n * Helper function to retrieve attribute value.\n * @param {String} suffix\n * @param {Element} element\n */\n\nfunction getAttributeValue(suffix, element) {\n var attribute = \"data-clipboard-\".concat(suffix);\n\n if (!element.hasAttribute(attribute)) {\n return;\n }\n\n return element.getAttribute(attribute);\n}\n/**\n * Base class which takes one or more elements, adds event listeners to them,\n * and instantiates a new `ClipboardAction` on each click.\n */\n\n\nvar Clipboard = /*#__PURE__*/function (_Emitter) {\n _inherits(Clipboard, _Emitter);\n\n var _super = _createSuper(Clipboard);\n\n /**\n * @param {String|HTMLElement|HTMLCollection|NodeList} trigger\n * @param {Object} options\n */\n function Clipboard(trigger, options) {\n var _this;\n\n _classCallCheck(this, Clipboard);\n\n _this = _super.call(this);\n\n _this.resolveOptions(options);\n\n _this.listenClick(trigger);\n\n return _this;\n }\n /**\n * Defines if attributes would be resolved using internal setter functions\n * or custom functions that were passed in the constructor.\n * @param {Object} options\n */\n\n\n _createClass(Clipboard, [{\n key: \"resolveOptions\",\n value: function resolveOptions() {\n var options = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : {};\n this.action = typeof options.action === 'function' ? options.action : this.defaultAction;\n this.target = typeof options.target === 'function' ? options.target : this.defaultTarget;\n this.text = typeof options.text === 'function' ? options.text : this.defaultText;\n this.container = clipboard_typeof(options.container) === 'object' ? options.container : document.body;\n }\n /**\n * Adds a click event listener to the passed trigger.\n * @param {String|HTMLElement|HTMLCollection|NodeList} trigger\n */\n\n }, {\n key: \"listenClick\",\n value: function listenClick(trigger) {\n var _this2 = this;\n\n this.listener = listen_default()(trigger, 'click', function (e) {\n return _this2.onClick(e);\n });\n }\n /**\n * Defines a new `ClipboardAction` on each click event.\n * @param {Event} e\n */\n\n }, {\n key: \"onClick\",\n value: function onClick(e) {\n var trigger = e.delegateTarget || e.currentTarget;\n var action = this.action(trigger) || 'copy';\n var text = actions_default({\n action: action,\n container: this.container,\n target: this.target(trigger),\n text: this.text(trigger)\n }); // Fires an event based on the copy operation result.\n\n this.emit(text ? 'success' : 'error', {\n action: action,\n text: text,\n trigger: trigger,\n clearSelection: function clearSelection() {\n if (trigger) {\n trigger.focus();\n }\n\n window.getSelection().removeAllRanges();\n }\n });\n }\n /**\n * Default `action` lookup function.\n * @param {Element} trigger\n */\n\n }, {\n key: \"defaultAction\",\n value: function defaultAction(trigger) {\n return getAttributeValue('action', trigger);\n }\n /**\n * Default `target` lookup function.\n * @param {Element} trigger\n */\n\n }, {\n key: \"defaultTarget\",\n value: function defaultTarget(trigger) {\n var selector = getAttributeValue('target', trigger);\n\n if (selector) {\n return document.querySelector(selector);\n }\n }\n /**\n * Allow fire programmatically a copy action\n * @param {String|HTMLElement} target\n * @param {Object} options\n * @returns Text copied.\n */\n\n }, {\n key: \"defaultText\",\n\n /**\n * Default `text` lookup function.\n * @param {Element} trigger\n */\n value: function defaultText(trigger) {\n return getAttributeValue('text', trigger);\n }\n /**\n * Destroy lifecycle.\n */\n\n }, {\n key: \"destroy\",\n value: function destroy() {\n this.listener.destroy();\n }\n }], [{\n key: \"copy\",\n value: function copy(target) {\n var options = arguments.length > 1 && arguments[1] !== undefined ? arguments[1] : {\n container: document.body\n };\n return actions_copy(target, options);\n }\n /**\n * Allow fire programmatically a cut action\n * @param {String|HTMLElement} target\n * @returns Text cutted.\n */\n\n }, {\n key: \"cut\",\n value: function cut(target) {\n return actions_cut(target);\n }\n /**\n * Returns the support of the given action, or all actions if no action is\n * given.\n * @param {String} [action]\n */\n\n }, {\n key: \"isSupported\",\n value: function isSupported() {\n var action = arguments.length > 0 && arguments[0] !== undefined ? arguments[0] : ['copy', 'cut'];\n var actions = typeof action === 'string' ? [action] : action;\n var support = !!document.queryCommandSupported;\n actions.forEach(function (action) {\n support = support && !!document.queryCommandSupported(action);\n });\n return support;\n }\n }]);\n\n return Clipboard;\n}((tiny_emitter_default()));\n\n/* harmony default export */ var clipboard = (Clipboard);\n\n/***/ }),\n\n/***/ 828:\n/***/ (function(module) {\n\nvar DOCUMENT_NODE_TYPE = 9;\n\n/**\n * A polyfill for Element.matches()\n */\nif (typeof Element !== 'undefined' && !Element.prototype.matches) {\n var proto = Element.prototype;\n\n proto.matches = proto.matchesSelector ||\n proto.mozMatchesSelector ||\n proto.msMatchesSelector ||\n proto.oMatchesSelector ||\n proto.webkitMatchesSelector;\n}\n\n/**\n * Finds the closest parent that matches a selector.\n *\n * @param {Element} element\n * @param {String} selector\n * @return {Function}\n */\nfunction closest (element, selector) {\n while (element && element.nodeType !== DOCUMENT_NODE_TYPE) {\n if (typeof element.matches === 'function' &&\n element.matches(selector)) {\n return element;\n }\n element = element.parentNode;\n }\n}\n\nmodule.exports = closest;\n\n\n/***/ }),\n\n/***/ 438:\n/***/ (function(module, __unused_webpack_exports, __webpack_require__) {\n\nvar closest = __webpack_require__(828);\n\n/**\n * Delegates event to a selector.\n *\n * @param {Element} element\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @param {Boolean} useCapture\n * @return {Object}\n */\nfunction _delegate(element, selector, type, callback, useCapture) {\n var listenerFn = listener.apply(this, arguments);\n\n element.addEventListener(type, listenerFn, useCapture);\n\n return {\n destroy: function() {\n element.removeEventListener(type, listenerFn, useCapture);\n }\n }\n}\n\n/**\n * Delegates event to a selector.\n *\n * @param {Element|String|Array} [elements]\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @param {Boolean} useCapture\n * @return {Object}\n */\nfunction delegate(elements, selector, type, callback, useCapture) {\n // Handle the regular Element usage\n if (typeof elements.addEventListener === 'function') {\n return _delegate.apply(null, arguments);\n }\n\n // Handle Element-less usage, it defaults to global delegation\n if (typeof type === 'function') {\n // Use `document` as the first parameter, then apply arguments\n // This is a short way to .unshift `arguments` without running into deoptimizations\n return _delegate.bind(null, document).apply(null, arguments);\n }\n\n // Handle Selector-based usage\n if (typeof elements === 'string') {\n elements = document.querySelectorAll(elements);\n }\n\n // Handle Array-like based usage\n return Array.prototype.map.call(elements, function (element) {\n return _delegate(element, selector, type, callback, useCapture);\n });\n}\n\n/**\n * Finds closest match and invokes callback.\n *\n * @param {Element} element\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @return {Function}\n */\nfunction listener(element, selector, type, callback) {\n return function(e) {\n e.delegateTarget = closest(e.target, selector);\n\n if (e.delegateTarget) {\n callback.call(element, e);\n }\n }\n}\n\nmodule.exports = delegate;\n\n\n/***/ }),\n\n/***/ 879:\n/***/ (function(__unused_webpack_module, exports) {\n\n/**\n * Check if argument is a HTML element.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.node = function(value) {\n return value !== undefined\n && value instanceof HTMLElement\n && value.nodeType === 1;\n};\n\n/**\n * Check if argument is a list of HTML elements.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.nodeList = function(value) {\n var type = Object.prototype.toString.call(value);\n\n return value !== undefined\n && (type === '[object NodeList]' || type === '[object HTMLCollection]')\n && ('length' in value)\n && (value.length === 0 || exports.node(value[0]));\n};\n\n/**\n * Check if argument is a string.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.string = function(value) {\n return typeof value === 'string'\n || value instanceof String;\n};\n\n/**\n * Check if argument is a function.\n *\n * @param {Object} value\n * @return {Boolean}\n */\nexports.fn = function(value) {\n var type = Object.prototype.toString.call(value);\n\n return type === '[object Function]';\n};\n\n\n/***/ }),\n\n/***/ 370:\n/***/ (function(module, __unused_webpack_exports, __webpack_require__) {\n\nvar is = __webpack_require__(879);\nvar delegate = __webpack_require__(438);\n\n/**\n * Validates all params and calls the right\n * listener function based on its target type.\n *\n * @param {String|HTMLElement|HTMLCollection|NodeList} target\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listen(target, type, callback) {\n if (!target && !type && !callback) {\n throw new Error('Missing required arguments');\n }\n\n if (!is.string(type)) {\n throw new TypeError('Second argument must be a String');\n }\n\n if (!is.fn(callback)) {\n throw new TypeError('Third argument must be a Function');\n }\n\n if (is.node(target)) {\n return listenNode(target, type, callback);\n }\n else if (is.nodeList(target)) {\n return listenNodeList(target, type, callback);\n }\n else if (is.string(target)) {\n return listenSelector(target, type, callback);\n }\n else {\n throw new TypeError('First argument must be a String, HTMLElement, HTMLCollection, or NodeList');\n }\n}\n\n/**\n * Adds an event listener to a HTML element\n * and returns a remove listener function.\n *\n * @param {HTMLElement} node\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenNode(node, type, callback) {\n node.addEventListener(type, callback);\n\n return {\n destroy: function() {\n node.removeEventListener(type, callback);\n }\n }\n}\n\n/**\n * Add an event listener to a list of HTML elements\n * and returns a remove listener function.\n *\n * @param {NodeList|HTMLCollection} nodeList\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenNodeList(nodeList, type, callback) {\n Array.prototype.forEach.call(nodeList, function(node) {\n node.addEventListener(type, callback);\n });\n\n return {\n destroy: function() {\n Array.prototype.forEach.call(nodeList, function(node) {\n node.removeEventListener(type, callback);\n });\n }\n }\n}\n\n/**\n * Add an event listener to a selector\n * and returns a remove listener function.\n *\n * @param {String} selector\n * @param {String} type\n * @param {Function} callback\n * @return {Object}\n */\nfunction listenSelector(selector, type, callback) {\n return delegate(document.body, selector, type, callback);\n}\n\nmodule.exports = listen;\n\n\n/***/ }),\n\n/***/ 817:\n/***/ (function(module) {\n\nfunction select(element) {\n var selectedText;\n\n if (element.nodeName === 'SELECT') {\n element.focus();\n\n selectedText = element.value;\n }\n else if (element.nodeName === 'INPUT' || element.nodeName === 'TEXTAREA') {\n var isReadOnly = element.hasAttribute('readonly');\n\n if (!isReadOnly) {\n element.setAttribute('readonly', '');\n }\n\n element.select();\n element.setSelectionRange(0, element.value.length);\n\n if (!isReadOnly) {\n element.removeAttribute('readonly');\n }\n\n selectedText = element.value;\n }\n else {\n if (element.hasAttribute('contenteditable')) {\n element.focus();\n }\n\n var selection = window.getSelection();\n var range = document.createRange();\n\n range.selectNodeContents(element);\n selection.removeAllRanges();\n selection.addRange(range);\n\n selectedText = selection.toString();\n }\n\n return selectedText;\n}\n\nmodule.exports = select;\n\n\n/***/ }),\n\n/***/ 279:\n/***/ (function(module) {\n\nfunction E () {\n // Keep this empty so it's easier to inherit from\n // (via https://github.com/lipsmack from https://github.com/scottcorgan/tiny-emitter/issues/3)\n}\n\nE.prototype = {\n on: function (name, callback, ctx) {\n var e = this.e || (this.e = {});\n\n (e[name] || (e[name] = [])).push({\n fn: callback,\n ctx: ctx\n });\n\n return this;\n },\n\n once: function (name, callback, ctx) {\n var self = this;\n function listener () {\n self.off(name, listener);\n callback.apply(ctx, arguments);\n };\n\n listener._ = callback\n return this.on(name, listener, ctx);\n },\n\n emit: function (name) {\n var data = [].slice.call(arguments, 1);\n var evtArr = ((this.e || (this.e = {}))[name] || []).slice();\n var i = 0;\n var len = evtArr.length;\n\n for (i; i < len; i++) {\n evtArr[i].fn.apply(evtArr[i].ctx, data);\n }\n\n return this;\n },\n\n off: function (name, callback) {\n var e = this.e || (this.e = {});\n var evts = e[name];\n var liveEvents = [];\n\n if (evts && callback) {\n for (var i = 0, len = evts.length; i < len; i++) {\n if (evts[i].fn !== callback && evts[i].fn._ !== callback)\n liveEvents.push(evts[i]);\n }\n }\n\n // Remove event from queue to prevent memory leak\n // Suggested by https://github.com/lazd\n // Ref: https://github.com/scottcorgan/tiny-emitter/commit/c6ebfaa9bc973b33d110a84a307742b7cf94c953#commitcomment-5024910\n\n (liveEvents.length)\n ? e[name] = liveEvents\n : delete e[name];\n\n return this;\n }\n};\n\nmodule.exports = E;\nmodule.exports.TinyEmitter = E;\n\n\n/***/ })\n\n/******/ \t});\n/************************************************************************/\n/******/ \t// The module cache\n/******/ \tvar __webpack_module_cache__ = {};\n/******/ \t\n/******/ \t// The require function\n/******/ \tfunction __webpack_require__(moduleId) {\n/******/ \t\t// Check if module is in cache\n/******/ \t\tif(__webpack_module_cache__[moduleId]) {\n/******/ \t\t\treturn __webpack_module_cache__[moduleId].exports;\n/******/ \t\t}\n/******/ \t\t// Create a new module (and put it into the cache)\n/******/ \t\tvar module = __webpack_module_cache__[moduleId] = {\n/******/ \t\t\t// no module.id needed\n/******/ \t\t\t// no module.loaded needed\n/******/ \t\t\texports: {}\n/******/ \t\t};\n/******/ \t\n/******/ \t\t// Execute the module function\n/******/ \t\t__webpack_modules__[moduleId](module, module.exports, __webpack_require__);\n/******/ \t\n/******/ \t\t// Return the exports of the module\n/******/ \t\treturn module.exports;\n/******/ \t}\n/******/ \t\n/************************************************************************/\n/******/ \t/* webpack/runtime/compat get default export */\n/******/ \t!function() {\n/******/ \t\t// getDefaultExport function for compatibility with non-harmony modules\n/******/ \t\t__webpack_require__.n = function(module) {\n/******/ \t\t\tvar getter = module && module.__esModule ?\n/******/ \t\t\t\tfunction() { return module['default']; } :\n/******/ \t\t\t\tfunction() { return module; };\n/******/ \t\t\t__webpack_require__.d(getter, { a: getter });\n/******/ \t\t\treturn getter;\n/******/ \t\t};\n/******/ \t}();\n/******/ \t\n/******/ \t/* webpack/runtime/define property getters */\n/******/ \t!function() {\n/******/ \t\t// define getter functions for harmony exports\n/******/ \t\t__webpack_require__.d = function(exports, definition) {\n/******/ \t\t\tfor(var key in definition) {\n/******/ \t\t\t\tif(__webpack_require__.o(definition, key) && !__webpack_require__.o(exports, key)) {\n/******/ \t\t\t\t\tObject.defineProperty(exports, key, { enumerable: true, get: definition[key] });\n/******/ \t\t\t\t}\n/******/ \t\t\t}\n/******/ \t\t};\n/******/ \t}();\n/******/ \t\n/******/ \t/* webpack/runtime/hasOwnProperty shorthand */\n/******/ \t!function() {\n/******/ \t\t__webpack_require__.o = function(obj, prop) { return Object.prototype.hasOwnProperty.call(obj, prop); }\n/******/ \t}();\n/******/ \t\n/************************************************************************/\n/******/ \t// module exports must be returned from runtime so entry inlining is disabled\n/******/ \t// startup\n/******/ \t// Load entry module and return exports\n/******/ \treturn __webpack_require__(686);\n/******/ })()\n.default;\n});", "/*!\n * escape-html\n * Copyright(c) 2012-2013 TJ Holowaychuk\n * Copyright(c) 2015 Andreas Lubbe\n * Copyright(c) 2015 Tiancheng \"Timothy\" Gu\n * MIT Licensed\n */\n\n'use strict';\n\n/**\n * Module variables.\n * @private\n */\n\nvar matchHtmlRegExp = /[\"'&<>]/;\n\n/**\n * Module exports.\n * @public\n */\n\nmodule.exports = escapeHtml;\n\n/**\n * Escape special characters in the given string of html.\n *\n * @param {string} string The string to escape for inserting into HTML\n * @return {string}\n * @public\n */\n\nfunction escapeHtml(string) {\n var str = '' + string;\n var match = matchHtmlRegExp.exec(str);\n\n if (!match) {\n return str;\n }\n\n var escape;\n var html = '';\n var index = 0;\n var lastIndex = 0;\n\n for (index = match.index; index < str.length; index++) {\n switch (str.charCodeAt(index)) {\n case 34: // \"\n escape = '"';\n break;\n case 38: // &\n escape = '&';\n break;\n case 39: // '\n escape = ''';\n break;\n case 60: // <\n escape = '<';\n break;\n case 62: // >\n escape = '>';\n break;\n default:\n continue;\n }\n\n if (lastIndex !== index) {\n html += str.substring(lastIndex, index);\n }\n\n lastIndex = index + 1;\n html += escape;\n }\n\n return lastIndex !== index\n ? html + str.substring(lastIndex, index)\n : html;\n}\n", "/*\n * Copyright (c) 2016-2024 Martin Donath \n *\n * Permission is hereby granted, free of charge, to any person obtaining a copy\n * of this software and associated documentation files (the \"Software\"), to\n * deal in the Software without restriction, including without limitation the\n * rights to use, copy, modify, merge, publish, distribute, sublicense, and/or\n * sell copies of the Software, and to permit persons to whom the Software is\n * furnished to do so, subject to the following conditions:\n *\n * The above copyright notice and this permission notice shall be included in\n * all copies or substantial portions of the Software.\n *\n * THE SOFTWARE IS PROVIDED \"AS IS\", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR\n * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,\n * FITNESS FOR A PARTICULAR PURPOSE AND NON-INFRINGEMENT. IN NO EVENT SHALL THE\n * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER\n * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING\n * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS\n * IN THE SOFTWARE.\n */\n\nimport \"focus-visible\"\n\nimport {\n EMPTY,\n NEVER,\n Observable,\n Subject,\n defer,\n delay,\n filter,\n map,\n merge,\n mergeWith,\n shareReplay,\n switchMap\n} from \"rxjs\"\n\nimport { configuration, feature } from \"./_\"\nimport {\n at,\n getActiveElement,\n getOptionalElement,\n requestJSON,\n setLocation,\n setToggle,\n watchDocument,\n watchKeyboard,\n watchLocation,\n watchLocationTarget,\n watchMedia,\n watchPrint,\n watchScript,\n watchViewport\n} from \"./browser\"\nimport {\n getComponentElement,\n getComponentElements,\n mountAnnounce,\n mountBackToTop,\n mountConsent,\n mountContent,\n mountDialog,\n mountHeader,\n mountHeaderTitle,\n mountPalette,\n mountProgress,\n mountSearch,\n mountSearchHiglight,\n mountSidebar,\n mountSource,\n mountTableOfContents,\n mountTabs,\n watchHeader,\n watchMain\n} from \"./components\"\nimport {\n SearchIndex,\n setupClipboardJS,\n setupInstantNavigation,\n setupVersionSelector\n} from \"./integrations\"\nimport {\n patchEllipsis,\n patchIndeterminate,\n patchScrollfix,\n patchScrolllock\n} from \"./patches\"\nimport \"./polyfills\"\n\n/* ----------------------------------------------------------------------------\n * Functions - @todo refactor\n * ------------------------------------------------------------------------- */\n\n/**\n * Fetch search index\n *\n * @returns Search index observable\n */\nfunction fetchSearchIndex(): Observable {\n if (location.protocol === \"file:\") {\n return watchScript(\n `${new URL(\"search/search_index.js\", config.base)}`\n )\n .pipe(\n // @ts-ignore - @todo fix typings\n map(() => __index),\n shareReplay(1)\n )\n } else {\n return requestJSON(\n new URL(\"search/search_index.json\", config.base)\n )\n }\n}\n\n/* ----------------------------------------------------------------------------\n * Application\n * ------------------------------------------------------------------------- */\n\n/* Yay, JavaScript is available */\ndocument.documentElement.classList.remove(\"no-js\")\ndocument.documentElement.classList.add(\"js\")\n\n/* Set up navigation observables and subjects */\nconst document$ = watchDocument()\nconst location$ = watchLocation()\nconst target$ = watchLocationTarget(location$)\nconst keyboard$ = watchKeyboard()\n\n/* Set up media observables */\nconst viewport$ = watchViewport()\nconst tablet$ = watchMedia(\"(min-width: 960px)\")\nconst screen$ = watchMedia(\"(min-width: 1220px)\")\nconst print$ = watchPrint()\n\n/* Retrieve search index, if search is enabled */\nconst config = configuration()\nconst index$ = document.forms.namedItem(\"search\")\n ? fetchSearchIndex()\n : NEVER\n\n/* Set up Clipboard.js integration */\nconst alert$ = new Subject()\nsetupClipboardJS({ alert$ })\n\n/* Set up progress indicator */\nconst progress$ = new Subject()\n\n/* Set up instant navigation, if enabled */\nif (feature(\"navigation.instant\"))\n setupInstantNavigation({ location$, viewport$, progress$ })\n .subscribe(document$)\n\n/* Set up version selector */\nif (config.version?.provider === \"mike\")\n setupVersionSelector({ document$ })\n\n/* Always close drawer and search on navigation */\nmerge(location$, target$)\n .pipe(\n delay(125)\n )\n .subscribe(() => {\n setToggle(\"drawer\", false)\n setToggle(\"search\", false)\n })\n\n/* Set up global keyboard handlers */\nkeyboard$\n .pipe(\n filter(({ mode }) => mode === \"global\")\n )\n .subscribe(key => {\n switch (key.type) {\n\n /* Go to previous page */\n case \"p\":\n case \",\":\n const prev = getOptionalElement(\"link[rel=prev]\")\n if (typeof prev !== \"undefined\")\n setLocation(prev)\n break\n\n /* Go to next page */\n case \"n\":\n case \".\":\n const next = getOptionalElement(\"link[rel=next]\")\n if (typeof next !== \"undefined\")\n setLocation(next)\n break\n\n /* Expand navigation, see https://bit.ly/3ZjG5io */\n case \"Enter\":\n const active = getActiveElement()\n if (active instanceof HTMLLabelElement)\n active.click()\n }\n })\n\n/* Set up patches */\npatchEllipsis({ viewport$, document$ })\npatchIndeterminate({ document$, tablet$ })\npatchScrollfix({ document$ })\npatchScrolllock({ viewport$, tablet$ })\n\n/* Set up header and main area observable */\nconst header$ = watchHeader(getComponentElement(\"header\"), { viewport$ })\nconst main$ = document$\n .pipe(\n map(() => getComponentElement(\"main\")),\n switchMap(el => watchMain(el, { viewport$, header$ })),\n shareReplay(1)\n )\n\n/* Set up control component observables */\nconst control$ = merge(\n\n /* Consent */\n ...getComponentElements(\"consent\")\n .map(el => mountConsent(el, { target$ })),\n\n /* Dialog */\n ...getComponentElements(\"dialog\")\n .map(el => mountDialog(el, { alert$ })),\n\n /* Header */\n ...getComponentElements(\"header\")\n .map(el => mountHeader(el, { viewport$, header$, main$ })),\n\n /* Color palette */\n ...getComponentElements(\"palette\")\n .map(el => mountPalette(el)),\n\n /* Progress bar */\n ...getComponentElements(\"progress\")\n .map(el => mountProgress(el, { progress$ })),\n\n /* Search */\n ...getComponentElements(\"search\")\n .map(el => mountSearch(el, { index$, keyboard$ })),\n\n /* Repository information */\n ...getComponentElements(\"source\")\n .map(el => mountSource(el))\n)\n\n/* Set up content component observables */\nconst content$ = defer(() => merge(\n\n /* Announcement bar */\n ...getComponentElements(\"announce\")\n .map(el => mountAnnounce(el)),\n\n /* Content */\n ...getComponentElements(\"content\")\n .map(el => mountContent(el, { viewport$, target$, print$ })),\n\n /* Search highlighting */\n ...getComponentElements(\"content\")\n .map(el => feature(\"search.highlight\")\n ? mountSearchHiglight(el, { index$, location$ })\n : EMPTY\n ),\n\n /* Header title */\n ...getComponentElements(\"header-title\")\n .map(el => mountHeaderTitle(el, { viewport$, header$ })),\n\n /* Sidebar */\n ...getComponentElements(\"sidebar\")\n .map(el => el.getAttribute(\"data-md-type\") === \"navigation\"\n ? at(screen$, () => mountSidebar(el, { viewport$, header$, main$ }))\n : at(tablet$, () => mountSidebar(el, { viewport$, header$, main$ }))\n ),\n\n /* Navigation tabs */\n ...getComponentElements(\"tabs\")\n .map(el => mountTabs(el, { viewport$, header$ })),\n\n /* Table of contents */\n ...getComponentElements(\"toc\")\n .map(el => mountTableOfContents(el, {\n viewport$, header$, main$, target$\n })),\n\n /* Back-to-top button */\n ...getComponentElements(\"top\")\n .map(el => mountBackToTop(el, { viewport$, header$, main$, target$ }))\n))\n\n/* Set up component observables */\nconst component$ = document$\n .pipe(\n switchMap(() => content$),\n mergeWith(control$),\n shareReplay(1)\n )\n\n/* Subscribe to all components */\ncomponent$.subscribe()\n\n/* ----------------------------------------------------------------------------\n * Exports\n * ------------------------------------------------------------------------- */\n\nwindow.document$ = document$ /* Document observable */\nwindow.location$ = location$ /* Location subject */\nwindow.target$ = target$ /* Location target observable */\nwindow.keyboard$ = keyboard$ /* Keyboard observable */\nwindow.viewport$ = viewport$ /* Viewport observable */\nwindow.tablet$ = tablet$ /* Media tablet observable */\nwindow.screen$ = screen$ /* Media screen observable */\nwindow.print$ = print$ /* Media print observable */\nwindow.alert$ = alert$ /* Alert subject */\nwindow.progress$ = progress$ /* Progress indicator subject */\nwindow.component$ = component$ /* Component observable */\n", "/*! *****************************************************************************\r\nCopyright (c) Microsoft Corporation.\r\n\r\nPermission to use, copy, modify, and/or distribute this software for any\r\npurpose with or without fee is hereby granted.\r\n\r\nTHE SOFTWARE IS PROVIDED \"AS IS\" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH\r\nREGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY\r\nAND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT,\r\nINDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM\r\nLOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR\r\nOTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR\r\nPERFORMANCE OF THIS SOFTWARE.\r\n***************************************************************************** */\r\n/* global Reflect, Promise */\r\n\r\nvar extendStatics = function(d, b) {\r\n extendStatics = Object.setPrototypeOf ||\r\n ({ __proto__: [] } instanceof Array && function (d, b) { d.__proto__ = b; }) ||\r\n function (d, b) { for (var p in b) if (Object.prototype.hasOwnProperty.call(b, p)) d[p] = b[p]; };\r\n return extendStatics(d, b);\r\n};\r\n\r\nexport function __extends(d, b) {\r\n if (typeof b !== \"function\" && b !== null)\r\n throw new TypeError(\"Class extends value \" + String(b) + \" is not a constructor or null\");\r\n extendStatics(d, b);\r\n function __() { this.constructor = d; }\r\n d.prototype = b === null ? Object.create(b) : (__.prototype = b.prototype, new __());\r\n}\r\n\r\nexport var __assign = function() {\r\n __assign = Object.assign || function __assign(t) {\r\n for (var s, i = 1, n = arguments.length; i < n; i++) {\r\n s = arguments[i];\r\n for (var p in s) if (Object.prototype.hasOwnProperty.call(s, p)) t[p] = s[p];\r\n }\r\n return t;\r\n }\r\n return __assign.apply(this, arguments);\r\n}\r\n\r\nexport function __rest(s, e) {\r\n var t = {};\r\n for (var p in s) if (Object.prototype.hasOwnProperty.call(s, p) && e.indexOf(p) < 0)\r\n t[p] = s[p];\r\n if (s != null && typeof Object.getOwnPropertySymbols === \"function\")\r\n for (var i = 0, p = Object.getOwnPropertySymbols(s); i < p.length; i++) {\r\n if (e.indexOf(p[i]) < 0 && Object.prototype.propertyIsEnumerable.call(s, p[i]))\r\n t[p[i]] = s[p[i]];\r\n }\r\n return t;\r\n}\r\n\r\nexport function __decorate(decorators, target, key, desc) {\r\n var c = arguments.length, r = c < 3 ? target : desc === null ? desc = Object.getOwnPropertyDescriptor(target, key) : desc, d;\r\n if (typeof Reflect === \"object\" && typeof Reflect.decorate === \"function\") r = Reflect.decorate(decorators, target, key, desc);\r\n else for (var i = decorators.length - 1; i >= 0; i--) if (d = decorators[i]) r = (c < 3 ? d(r) : c > 3 ? d(target, key, r) : d(target, key)) || r;\r\n return c > 3 && r && Object.defineProperty(target, key, r), r;\r\n}\r\n\r\nexport function __param(paramIndex, decorator) {\r\n return function (target, key) { decorator(target, key, paramIndex); }\r\n}\r\n\r\nexport function __metadata(metadataKey, metadataValue) {\r\n if (typeof Reflect === \"object\" && typeof Reflect.metadata === \"function\") return Reflect.metadata(metadataKey, metadataValue);\r\n}\r\n\r\nexport function __awaiter(thisArg, _arguments, P, generator) {\r\n function adopt(value) { return value instanceof P ? value : new P(function (resolve) { resolve(value); }); }\r\n return new (P || (P = Promise))(function (resolve, reject) {\r\n function fulfilled(value) { try { step(generator.next(value)); } catch (e) { reject(e); } }\r\n function rejected(value) { try { step(generator[\"throw\"](value)); } catch (e) { reject(e); } }\r\n function step(result) { result.done ? resolve(result.value) : adopt(result.value).then(fulfilled, rejected); }\r\n step((generator = generator.apply(thisArg, _arguments || [])).next());\r\n });\r\n}\r\n\r\nexport function __generator(thisArg, body) {\r\n var _ = { label: 0, sent: function() { if (t[0] & 1) throw t[1]; return t[1]; }, trys: [], ops: [] }, f, y, t, g;\r\n return g = { next: verb(0), \"throw\": verb(1), \"return\": verb(2) }, typeof Symbol === \"function\" && (g[Symbol.iterator] = function() { return this; }), g;\r\n function verb(n) { return function (v) { return step([n, v]); }; }\r\n function step(op) {\r\n if (f) throw new TypeError(\"Generator is already executing.\");\r\n while (_) try {\r\n if (f = 1, y && (t = op[0] & 2 ? y[\"return\"] : op[0] ? y[\"throw\"] || ((t = y[\"return\"]) && t.call(y), 0) : y.next) && !(t = t.call(y, op[1])).done) return t;\r\n if (y = 0, t) op = [op[0] & 2, t.value];\r\n switch (op[0]) {\r\n case 0: case 1: t = op; break;\r\n case 4: _.label++; return { value: op[1], done: false };\r\n case 5: _.label++; y = op[1]; op = [0]; continue;\r\n case 7: op = _.ops.pop(); _.trys.pop(); continue;\r\n default:\r\n if (!(t = _.trys, t = t.length > 0 && t[t.length - 1]) && (op[0] === 6 || op[0] === 2)) { _ = 0; continue; }\r\n if (op[0] === 3 && (!t || (op[1] > t[0] && op[1] < t[3]))) { _.label = op[1]; break; }\r\n if (op[0] === 6 && _.label < t[1]) { _.label = t[1]; t = op; break; }\r\n if (t && _.label < t[2]) { _.label = t[2]; _.ops.push(op); break; }\r\n if (t[2]) _.ops.pop();\r\n _.trys.pop(); continue;\r\n }\r\n op = body.call(thisArg, _);\r\n } catch (e) { op = [6, e]; y = 0; } finally { f = t = 0; }\r\n if (op[0] & 5) throw op[1]; return { value: op[0] ? op[1] : void 0, done: true };\r\n }\r\n}\r\n\r\nexport var __createBinding = Object.create ? (function(o, m, k, k2) {\r\n if (k2 === undefined) k2 = k;\r\n Object.defineProperty(o, k2, { enumerable: true, get: function() { return m[k]; } });\r\n}) : (function(o, m, k, k2) {\r\n if (k2 === undefined) k2 = k;\r\n o[k2] = m[k];\r\n});\r\n\r\nexport function __exportStar(m, o) {\r\n for (var p in m) if (p !== \"default\" && !Object.prototype.hasOwnProperty.call(o, p)) __createBinding(o, m, p);\r\n}\r\n\r\nexport function __values(o) {\r\n var s = typeof Symbol === \"function\" && Symbol.iterator, m = s && o[s], i = 0;\r\n if (m) return m.call(o);\r\n if (o && typeof o.length === \"number\") return {\r\n next: function () {\r\n if (o && i >= o.length) o = void 0;\r\n return { value: o && o[i++], done: !o };\r\n }\r\n };\r\n throw new TypeError(s ? \"Object is not iterable.\" : \"Symbol.iterator is not defined.\");\r\n}\r\n\r\nexport function __read(o, n) {\r\n var m = typeof Symbol === \"function\" && o[Symbol.iterator];\r\n if (!m) return o;\r\n var i = m.call(o), r, ar = [], e;\r\n try {\r\n while ((n === void 0 || n-- > 0) && !(r = i.next()).done) ar.push(r.value);\r\n }\r\n catch (error) { e = { error: error }; }\r\n finally {\r\n try {\r\n if (r && !r.done && (m = i[\"return\"])) m.call(i);\r\n }\r\n finally { if (e) throw e.error; }\r\n }\r\n return ar;\r\n}\r\n\r\n/** @deprecated */\r\nexport function __spread() {\r\n for (var ar = [], i = 0; i < arguments.length; i++)\r\n ar = ar.concat(__read(arguments[i]));\r\n return ar;\r\n}\r\n\r\n/** @deprecated */\r\nexport function __spreadArrays() {\r\n for (var s = 0, i = 0, il = arguments.length; i < il; i++) s += arguments[i].length;\r\n for (var r = Array(s), k = 0, i = 0; i < il; i++)\r\n for (var a = arguments[i], j = 0, jl = a.length; j < jl; j++, k++)\r\n r[k] = a[j];\r\n return r;\r\n}\r\n\r\nexport function __spreadArray(to, from, pack) {\r\n if (pack || arguments.length === 2) for (var i = 0, l = from.length, ar; i < l; i++) {\r\n if (ar || !(i in from)) {\r\n if (!ar) ar = Array.prototype.slice.call(from, 0, i);\r\n ar[i] = from[i];\r\n }\r\n }\r\n return to.concat(ar || Array.prototype.slice.call(from));\r\n}\r\n\r\nexport function __await(v) {\r\n return this instanceof __await ? (this.v = v, this) : new __await(v);\r\n}\r\n\r\nexport function __asyncGenerator(thisArg, _arguments, generator) {\r\n if (!Symbol.asyncIterator) throw new TypeError(\"Symbol.asyncIterator is not defined.\");\r\n var g = generator.apply(thisArg, _arguments || []), i, q = [];\r\n return i = {}, verb(\"next\"), verb(\"throw\"), verb(\"return\"), i[Symbol.asyncIterator] = function () { return this; }, i;\r\n function verb(n) { if (g[n]) i[n] = function (v) { return new Promise(function (a, b) { q.push([n, v, a, b]) > 1 || resume(n, v); }); }; }\r\n function resume(n, v) { try { step(g[n](v)); } catch (e) { settle(q[0][3], e); } }\r\n function step(r) { r.value instanceof __await ? Promise.resolve(r.value.v).then(fulfill, reject) : settle(q[0][2], r); }\r\n function fulfill(value) { resume(\"next\", value); }\r\n function reject(value) { resume(\"throw\", value); }\r\n function settle(f, v) { if (f(v), q.shift(), q.length) resume(q[0][0], q[0][1]); }\r\n}\r\n\r\nexport function __asyncDelegator(o) {\r\n var i, p;\r\n return i = {}, verb(\"next\"), verb(\"throw\", function (e) { throw e; }), verb(\"return\"), i[Symbol.iterator] = function () { return this; }, i;\r\n function verb(n, f) { i[n] = o[n] ? function (v) { return (p = !p) ? { value: __await(o[n](v)), done: n === \"return\" } : f ? f(v) : v; } : f; }\r\n}\r\n\r\nexport function __asyncValues(o) {\r\n if (!Symbol.asyncIterator) throw new TypeError(\"Symbol.asyncIterator is not defined.\");\r\n var m = o[Symbol.asyncIterator], i;\r\n return m ? m.call(o) : (o = typeof __values === \"function\" ? __values(o) : o[Symbol.iterator](), i = {}, verb(\"next\"), verb(\"throw\"), verb(\"return\"), i[Symbol.asyncIterator] = function () { return this; }, i);\r\n function verb(n) { i[n] = o[n] && function (v) { return new Promise(function (resolve, reject) { v = o[n](v), settle(resolve, reject, v.done, v.value); }); }; }\r\n function settle(resolve, reject, d, v) { Promise.resolve(v).then(function(v) { resolve({ value: v, done: d }); }, reject); }\r\n}\r\n\r\nexport function __makeTemplateObject(cooked, raw) {\r\n if (Object.defineProperty) { Object.defineProperty(cooked, \"raw\", { value: raw }); } else { cooked.raw = raw; }\r\n return cooked;\r\n};\r\n\r\nvar __setModuleDefault = Object.create ? (function(o, v) {\r\n Object.defineProperty(o, \"default\", { enumerable: true, value: v });\r\n}) : function(o, v) {\r\n o[\"default\"] = v;\r\n};\r\n\r\nexport function __importStar(mod) {\r\n if (mod && mod.__esModule) return mod;\r\n var result = {};\r\n if (mod != null) for (var k in mod) if (k !== \"default\" && Object.prototype.hasOwnProperty.call(mod, k)) __createBinding(result, mod, k);\r\n __setModuleDefault(result, mod);\r\n return result;\r\n}\r\n\r\nexport function __importDefault(mod) {\r\n return (mod && mod.__esModule) ? mod : { default: mod };\r\n}\r\n\r\nexport function __classPrivateFieldGet(receiver, state, kind, f) {\r\n if (kind === \"a\" && !f) throw new TypeError(\"Private accessor was defined without a getter\");\r\n if (typeof state === \"function\" ? receiver !== state || !f : !state.has(receiver)) throw new TypeError(\"Cannot read private member from an object whose class did not declare it\");\r\n return kind === \"m\" ? f : kind === \"a\" ? f.call(receiver) : f ? f.value : state.get(receiver);\r\n}\r\n\r\nexport function __classPrivateFieldSet(receiver, state, value, kind, f) {\r\n if (kind === \"m\") throw new TypeError(\"Private method is not writable\");\r\n if (kind === \"a\" && !f) throw new TypeError(\"Private accessor was defined without a setter\");\r\n if (typeof state === \"function\" ? receiver !== state || !f : !state.has(receiver)) throw new TypeError(\"Cannot write private member to an object whose class did not declare it\");\r\n return (kind === \"a\" ? f.call(receiver, value) : f ? f.value = value : state.set(receiver, value)), value;\r\n}\r\n", "/**\n * Returns true if the object is a function.\n * @param value The value to check\n */\nexport function isFunction(value: any): value is (...args: any[]) => any {\n return typeof value === 'function';\n}\n", "/**\n * Used to create Error subclasses until the community moves away from ES5.\n *\n * This is because compiling from TypeScript down to ES5 has issues with subclassing Errors\n * as well as other built-in types: https://github.com/Microsoft/TypeScript/issues/12123\n *\n * @param createImpl A factory function to create the actual constructor implementation. The returned\n * function should be a named function that calls `_super` internally.\n */\nexport function createErrorClass(createImpl: (_super: any) => any): T {\n const _super = (instance: any) => {\n Error.call(instance);\n instance.stack = new Error().stack;\n };\n\n const ctorFunc = createImpl(_super);\n ctorFunc.prototype = Object.create(Error.prototype);\n ctorFunc.prototype.constructor = ctorFunc;\n return ctorFunc;\n}\n", "import { createErrorClass } from './createErrorClass';\n\nexport interface UnsubscriptionError extends Error {\n readonly errors: any[];\n}\n\nexport interface UnsubscriptionErrorCtor {\n /**\n * @deprecated Internal implementation detail. Do not construct error instances.\n * Cannot be tagged as internal: https://github.com/ReactiveX/rxjs/issues/6269\n */\n new (errors: any[]): UnsubscriptionError;\n}\n\n/**\n * An error thrown when one or more errors have occurred during the\n * `unsubscribe` of a {@link Subscription}.\n */\nexport const UnsubscriptionError: UnsubscriptionErrorCtor = createErrorClass(\n (_super) =>\n function UnsubscriptionErrorImpl(this: any, errors: (Error | string)[]) {\n _super(this);\n this.message = errors\n ? `${errors.length} errors occurred during unsubscription:\n${errors.map((err, i) => `${i + 1}) ${err.toString()}`).join('\\n ')}`\n : '';\n this.name = 'UnsubscriptionError';\n this.errors = errors;\n }\n);\n", "/**\n * Removes an item from an array, mutating it.\n * @param arr The array to remove the item from\n * @param item The item to remove\n */\nexport function arrRemove(arr: T[] | undefined | null, item: T) {\n if (arr) {\n const index = arr.indexOf(item);\n 0 <= index && arr.splice(index, 1);\n }\n}\n", "import { isFunction } from './util/isFunction';\nimport { UnsubscriptionError } from './util/UnsubscriptionError';\nimport { SubscriptionLike, TeardownLogic, Unsubscribable } from './types';\nimport { arrRemove } from './util/arrRemove';\n\n/**\n * Represents a disposable resource, such as the execution of an Observable. A\n * Subscription has one important method, `unsubscribe`, that takes no argument\n * and just disposes the resource held by the subscription.\n *\n * Additionally, subscriptions may be grouped together through the `add()`\n * method, which will attach a child Subscription to the current Subscription.\n * When a Subscription is unsubscribed, all its children (and its grandchildren)\n * will be unsubscribed as well.\n *\n * @class Subscription\n */\nexport class Subscription implements SubscriptionLike {\n /** @nocollapse */\n public static EMPTY = (() => {\n const empty = new Subscription();\n empty.closed = true;\n return empty;\n })();\n\n /**\n * A flag to indicate whether this Subscription has already been unsubscribed.\n */\n public closed = false;\n\n private _parentage: Subscription[] | Subscription | null = null;\n\n /**\n * The list of registered finalizers to execute upon unsubscription. Adding and removing from this\n * list occurs in the {@link #add} and {@link #remove} methods.\n */\n private _finalizers: Exclude[] | null = null;\n\n /**\n * @param initialTeardown A function executed first as part of the finalization\n * process that is kicked off when {@link #unsubscribe} is called.\n */\n constructor(private initialTeardown?: () => void) {}\n\n /**\n * Disposes the resources held by the subscription. May, for instance, cancel\n * an ongoing Observable execution or cancel any other type of work that\n * started when the Subscription was created.\n * @return {void}\n */\n unsubscribe(): void {\n let errors: any[] | undefined;\n\n if (!this.closed) {\n this.closed = true;\n\n // Remove this from it's parents.\n const { _parentage } = this;\n if (_parentage) {\n this._parentage = null;\n if (Array.isArray(_parentage)) {\n for (const parent of _parentage) {\n parent.remove(this);\n }\n } else {\n _parentage.remove(this);\n }\n }\n\n const { initialTeardown: initialFinalizer } = this;\n if (isFunction(initialFinalizer)) {\n try {\n initialFinalizer();\n } catch (e) {\n errors = e instanceof UnsubscriptionError ? e.errors : [e];\n }\n }\n\n const { _finalizers } = this;\n if (_finalizers) {\n this._finalizers = null;\n for (const finalizer of _finalizers) {\n try {\n execFinalizer(finalizer);\n } catch (err) {\n errors = errors ?? [];\n if (err instanceof UnsubscriptionError) {\n errors = [...errors, ...err.errors];\n } else {\n errors.push(err);\n }\n }\n }\n }\n\n if (errors) {\n throw new UnsubscriptionError(errors);\n }\n }\n }\n\n /**\n * Adds a finalizer to this subscription, so that finalization will be unsubscribed/called\n * when this subscription is unsubscribed. If this subscription is already {@link #closed},\n * because it has already been unsubscribed, then whatever finalizer is passed to it\n * will automatically be executed (unless the finalizer itself is also a closed subscription).\n *\n * Closed Subscriptions cannot be added as finalizers to any subscription. Adding a closed\n * subscription to a any subscription will result in no operation. (A noop).\n *\n * Adding a subscription to itself, or adding `null` or `undefined` will not perform any\n * operation at all. (A noop).\n *\n * `Subscription` instances that are added to this instance will automatically remove themselves\n * if they are unsubscribed. Functions and {@link Unsubscribable} objects that you wish to remove\n * will need to be removed manually with {@link #remove}\n *\n * @param teardown The finalization logic to add to this subscription.\n */\n add(teardown: TeardownLogic): void {\n // Only add the finalizer if it's not undefined\n // and don't add a subscription to itself.\n if (teardown && teardown !== this) {\n if (this.closed) {\n // If this subscription is already closed,\n // execute whatever finalizer is handed to it automatically.\n execFinalizer(teardown);\n } else {\n if (teardown instanceof Subscription) {\n // We don't add closed subscriptions, and we don't add the same subscription\n // twice. Subscription unsubscribe is idempotent.\n if (teardown.closed || teardown._hasParent(this)) {\n return;\n }\n teardown._addParent(this);\n }\n (this._finalizers = this._finalizers ?? []).push(teardown);\n }\n }\n }\n\n /**\n * Checks to see if a this subscription already has a particular parent.\n * This will signal that this subscription has already been added to the parent in question.\n * @param parent the parent to check for\n */\n private _hasParent(parent: Subscription) {\n const { _parentage } = this;\n return _parentage === parent || (Array.isArray(_parentage) && _parentage.includes(parent));\n }\n\n /**\n * Adds a parent to this subscription so it can be removed from the parent if it\n * unsubscribes on it's own.\n *\n * NOTE: THIS ASSUMES THAT {@link _hasParent} HAS ALREADY BEEN CHECKED.\n * @param parent The parent subscription to add\n */\n private _addParent(parent: Subscription) {\n const { _parentage } = this;\n this._parentage = Array.isArray(_parentage) ? (_parentage.push(parent), _parentage) : _parentage ? [_parentage, parent] : parent;\n }\n\n /**\n * Called on a child when it is removed via {@link #remove}.\n * @param parent The parent to remove\n */\n private _removeParent(parent: Subscription) {\n const { _parentage } = this;\n if (_parentage === parent) {\n this._parentage = null;\n } else if (Array.isArray(_parentage)) {\n arrRemove(_parentage, parent);\n }\n }\n\n /**\n * Removes a finalizer from this subscription that was previously added with the {@link #add} method.\n *\n * Note that `Subscription` instances, when unsubscribed, will automatically remove themselves\n * from every other `Subscription` they have been added to. This means that using the `remove` method\n * is not a common thing and should be used thoughtfully.\n *\n * If you add the same finalizer instance of a function or an unsubscribable object to a `Subscription` instance\n * more than once, you will need to call `remove` the same number of times to remove all instances.\n *\n * All finalizer instances are removed to free up memory upon unsubscription.\n *\n * @param teardown The finalizer to remove from this subscription\n */\n remove(teardown: Exclude): void {\n const { _finalizers } = this;\n _finalizers && arrRemove(_finalizers, teardown);\n\n if (teardown instanceof Subscription) {\n teardown._removeParent(this);\n }\n }\n}\n\nexport const EMPTY_SUBSCRIPTION = Subscription.EMPTY;\n\nexport function isSubscription(value: any): value is Subscription {\n return (\n value instanceof Subscription ||\n (value && 'closed' in value && isFunction(value.remove) && isFunction(value.add) && isFunction(value.unsubscribe))\n );\n}\n\nfunction execFinalizer(finalizer: Unsubscribable | (() => void)) {\n if (isFunction(finalizer)) {\n finalizer();\n } else {\n finalizer.unsubscribe();\n }\n}\n", "import { Subscriber } from './Subscriber';\nimport { ObservableNotification } from './types';\n\n/**\n * The {@link GlobalConfig} object for RxJS. It is used to configure things\n * like how to react on unhandled errors.\n */\nexport const config: GlobalConfig = {\n onUnhandledError: null,\n onStoppedNotification: null,\n Promise: undefined,\n useDeprecatedSynchronousErrorHandling: false,\n useDeprecatedNextContext: false,\n};\n\n/**\n * The global configuration object for RxJS, used to configure things\n * like how to react on unhandled errors. Accessible via {@link config}\n * object.\n */\nexport interface GlobalConfig {\n /**\n * A registration point for unhandled errors from RxJS. These are errors that\n * cannot were not handled by consuming code in the usual subscription path. For\n * example, if you have this configured, and you subscribe to an observable without\n * providing an error handler, errors from that subscription will end up here. This\n * will _always_ be called asynchronously on another job in the runtime. This is because\n * we do not want errors thrown in this user-configured handler to interfere with the\n * behavior of the library.\n */\n onUnhandledError: ((err: any) => void) | null;\n\n /**\n * A registration point for notifications that cannot be sent to subscribers because they\n * have completed, errored or have been explicitly unsubscribed. By default, next, complete\n * and error notifications sent to stopped subscribers are noops. However, sometimes callers\n * might want a different behavior. For example, with sources that attempt to report errors\n * to stopped subscribers, a caller can configure RxJS to throw an unhandled error instead.\n * This will _always_ be called asynchronously on another job in the runtime. This is because\n * we do not want errors thrown in this user-configured handler to interfere with the\n * behavior of the library.\n */\n onStoppedNotification: ((notification: ObservableNotification, subscriber: Subscriber) => void) | null;\n\n /**\n * The promise constructor used by default for {@link Observable#toPromise toPromise} and {@link Observable#forEach forEach}\n * methods.\n *\n * @deprecated As of version 8, RxJS will no longer support this sort of injection of a\n * Promise constructor. If you need a Promise implementation other than native promises,\n * please polyfill/patch Promise as you see appropriate. Will be removed in v8.\n */\n Promise?: PromiseConstructorLike;\n\n /**\n * If true, turns on synchronous error rethrowing, which is a deprecated behavior\n * in v6 and higher. This behavior enables bad patterns like wrapping a subscribe\n * call in a try/catch block. It also enables producer interference, a nasty bug\n * where a multicast can be broken for all observers by a downstream consumer with\n * an unhandled error. DO NOT USE THIS FLAG UNLESS IT'S NEEDED TO BUY TIME\n * FOR MIGRATION REASONS.\n *\n * @deprecated As of version 8, RxJS will no longer support synchronous throwing\n * of unhandled errors. All errors will be thrown on a separate call stack to prevent bad\n * behaviors described above. Will be removed in v8.\n */\n useDeprecatedSynchronousErrorHandling: boolean;\n\n /**\n * If true, enables an as-of-yet undocumented feature from v5: The ability to access\n * `unsubscribe()` via `this` context in `next` functions created in observers passed\n * to `subscribe`.\n *\n * This is being removed because the performance was severely problematic, and it could also cause\n * issues when types other than POJOs are passed to subscribe as subscribers, as they will likely have\n * their `this` context overwritten.\n *\n * @deprecated As of version 8, RxJS will no longer support altering the\n * context of next functions provided as part of an observer to Subscribe. Instead,\n * you will have access to a subscription or a signal or token that will allow you to do things like\n * unsubscribe and test closed status. Will be removed in v8.\n */\n useDeprecatedNextContext: boolean;\n}\n", "import type { TimerHandle } from './timerHandle';\ntype SetTimeoutFunction = (handler: () => void, timeout?: number, ...args: any[]) => TimerHandle;\ntype ClearTimeoutFunction = (handle: TimerHandle) => void;\n\ninterface TimeoutProvider {\n setTimeout: SetTimeoutFunction;\n clearTimeout: ClearTimeoutFunction;\n delegate:\n | {\n setTimeout: SetTimeoutFunction;\n clearTimeout: ClearTimeoutFunction;\n }\n | undefined;\n}\n\nexport const timeoutProvider: TimeoutProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n setTimeout(handler: () => void, timeout?: number, ...args) {\n const { delegate } = timeoutProvider;\n if (delegate?.setTimeout) {\n return delegate.setTimeout(handler, timeout, ...args);\n }\n return setTimeout(handler, timeout, ...args);\n },\n clearTimeout(handle) {\n const { delegate } = timeoutProvider;\n return (delegate?.clearTimeout || clearTimeout)(handle as any);\n },\n delegate: undefined,\n};\n", "import { config } from '../config';\nimport { timeoutProvider } from '../scheduler/timeoutProvider';\n\n/**\n * Handles an error on another job either with the user-configured {@link onUnhandledError},\n * or by throwing it on that new job so it can be picked up by `window.onerror`, `process.on('error')`, etc.\n *\n * This should be called whenever there is an error that is out-of-band with the subscription\n * or when an error hits a terminal boundary of the subscription and no error handler was provided.\n *\n * @param err the error to report\n */\nexport function reportUnhandledError(err: any) {\n timeoutProvider.setTimeout(() => {\n const { onUnhandledError } = config;\n if (onUnhandledError) {\n // Execute the user-configured error handler.\n onUnhandledError(err);\n } else {\n // Throw so it is picked up by the runtime's uncaught error mechanism.\n throw err;\n }\n });\n}\n", "/* tslint:disable:no-empty */\nexport function noop() { }\n", "import { CompleteNotification, NextNotification, ErrorNotification } from './types';\n\n/**\n * A completion object optimized for memory use and created to be the\n * same \"shape\" as other notifications in v8.\n * @internal\n */\nexport const COMPLETE_NOTIFICATION = (() => createNotification('C', undefined, undefined) as CompleteNotification)();\n\n/**\n * Internal use only. Creates an optimized error notification that is the same \"shape\"\n * as other notifications.\n * @internal\n */\nexport function errorNotification(error: any): ErrorNotification {\n return createNotification('E', undefined, error) as any;\n}\n\n/**\n * Internal use only. Creates an optimized next notification that is the same \"shape\"\n * as other notifications.\n * @internal\n */\nexport function nextNotification(value: T) {\n return createNotification('N', value, undefined) as NextNotification;\n}\n\n/**\n * Ensures that all notifications created internally have the same \"shape\" in v8.\n *\n * TODO: This is only exported to support a crazy legacy test in `groupBy`.\n * @internal\n */\nexport function createNotification(kind: 'N' | 'E' | 'C', value: any, error: any) {\n return {\n kind,\n value,\n error,\n };\n}\n", "import { config } from '../config';\n\nlet context: { errorThrown: boolean; error: any } | null = null;\n\n/**\n * Handles dealing with errors for super-gross mode. Creates a context, in which\n * any synchronously thrown errors will be passed to {@link captureError}. Which\n * will record the error such that it will be rethrown after the call back is complete.\n * TODO: Remove in v8\n * @param cb An immediately executed function.\n */\nexport function errorContext(cb: () => void) {\n if (config.useDeprecatedSynchronousErrorHandling) {\n const isRoot = !context;\n if (isRoot) {\n context = { errorThrown: false, error: null };\n }\n cb();\n if (isRoot) {\n const { errorThrown, error } = context!;\n context = null;\n if (errorThrown) {\n throw error;\n }\n }\n } else {\n // This is the general non-deprecated path for everyone that\n // isn't crazy enough to use super-gross mode (useDeprecatedSynchronousErrorHandling)\n cb();\n }\n}\n\n/**\n * Captures errors only in super-gross mode.\n * @param err the error to capture\n */\nexport function captureError(err: any) {\n if (config.useDeprecatedSynchronousErrorHandling && context) {\n context.errorThrown = true;\n context.error = err;\n }\n}\n", "import { isFunction } from './util/isFunction';\nimport { Observer, ObservableNotification } from './types';\nimport { isSubscription, Subscription } from './Subscription';\nimport { config } from './config';\nimport { reportUnhandledError } from './util/reportUnhandledError';\nimport { noop } from './util/noop';\nimport { nextNotification, errorNotification, COMPLETE_NOTIFICATION } from './NotificationFactories';\nimport { timeoutProvider } from './scheduler/timeoutProvider';\nimport { captureError } from './util/errorContext';\n\n/**\n * Implements the {@link Observer} interface and extends the\n * {@link Subscription} class. While the {@link Observer} is the public API for\n * consuming the values of an {@link Observable}, all Observers get converted to\n * a Subscriber, in order to provide Subscription-like capabilities such as\n * `unsubscribe`. Subscriber is a common type in RxJS, and crucial for\n * implementing operators, but it is rarely used as a public API.\n *\n * @class Subscriber\n */\nexport class Subscriber extends Subscription implements Observer {\n /**\n * A static factory for a Subscriber, given a (potentially partial) definition\n * of an Observer.\n * @param next The `next` callback of an Observer.\n * @param error The `error` callback of an\n * Observer.\n * @param complete The `complete` callback of an\n * Observer.\n * @return A Subscriber wrapping the (partially defined)\n * Observer represented by the given arguments.\n * @nocollapse\n * @deprecated Do not use. Will be removed in v8. There is no replacement for this\n * method, and there is no reason to be creating instances of `Subscriber` directly.\n * If you have a specific use case, please file an issue.\n */\n static create(next?: (x?: T) => void, error?: (e?: any) => void, complete?: () => void): Subscriber {\n return new SafeSubscriber(next, error, complete);\n }\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n protected isStopped: boolean = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n protected destination: Subscriber | Observer; // this `any` is the escape hatch to erase extra type param (e.g. R)\n\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n * There is no reason to directly create an instance of Subscriber. This type is exported for typings reasons.\n */\n constructor(destination?: Subscriber | Observer) {\n super();\n if (destination) {\n this.destination = destination;\n // Automatically chain subscriptions together here.\n // if destination is a Subscription, then it is a Subscriber.\n if (isSubscription(destination)) {\n destination.add(this);\n }\n } else {\n this.destination = EMPTY_OBSERVER;\n }\n }\n\n /**\n * The {@link Observer} callback to receive notifications of type `next` from\n * the Observable, with a value. The Observable may call this method 0 or more\n * times.\n * @param {T} [value] The `next` value.\n * @return {void}\n */\n next(value?: T): void {\n if (this.isStopped) {\n handleStoppedNotification(nextNotification(value), this);\n } else {\n this._next(value!);\n }\n }\n\n /**\n * The {@link Observer} callback to receive notifications of type `error` from\n * the Observable, with an attached `Error`. Notifies the Observer that\n * the Observable has experienced an error condition.\n * @param {any} [err] The `error` exception.\n * @return {void}\n */\n error(err?: any): void {\n if (this.isStopped) {\n handleStoppedNotification(errorNotification(err), this);\n } else {\n this.isStopped = true;\n this._error(err);\n }\n }\n\n /**\n * The {@link Observer} callback to receive a valueless notification of type\n * `complete` from the Observable. Notifies the Observer that the Observable\n * has finished sending push-based notifications.\n * @return {void}\n */\n complete(): void {\n if (this.isStopped) {\n handleStoppedNotification(COMPLETE_NOTIFICATION, this);\n } else {\n this.isStopped = true;\n this._complete();\n }\n }\n\n unsubscribe(): void {\n if (!this.closed) {\n this.isStopped = true;\n super.unsubscribe();\n this.destination = null!;\n }\n }\n\n protected _next(value: T): void {\n this.destination.next(value);\n }\n\n protected _error(err: any): void {\n try {\n this.destination.error(err);\n } finally {\n this.unsubscribe();\n }\n }\n\n protected _complete(): void {\n try {\n this.destination.complete();\n } finally {\n this.unsubscribe();\n }\n }\n}\n\n/**\n * This bind is captured here because we want to be able to have\n * compatibility with monoid libraries that tend to use a method named\n * `bind`. In particular, a library called Monio requires this.\n */\nconst _bind = Function.prototype.bind;\n\nfunction bind any>(fn: Fn, thisArg: any): Fn {\n return _bind.call(fn, thisArg);\n}\n\n/**\n * Internal optimization only, DO NOT EXPOSE.\n * @internal\n */\nclass ConsumerObserver implements Observer {\n constructor(private partialObserver: Partial>) {}\n\n next(value: T): void {\n const { partialObserver } = this;\n if (partialObserver.next) {\n try {\n partialObserver.next(value);\n } catch (error) {\n handleUnhandledError(error);\n }\n }\n }\n\n error(err: any): void {\n const { partialObserver } = this;\n if (partialObserver.error) {\n try {\n partialObserver.error(err);\n } catch (error) {\n handleUnhandledError(error);\n }\n } else {\n handleUnhandledError(err);\n }\n }\n\n complete(): void {\n const { partialObserver } = this;\n if (partialObserver.complete) {\n try {\n partialObserver.complete();\n } catch (error) {\n handleUnhandledError(error);\n }\n }\n }\n}\n\nexport class SafeSubscriber extends Subscriber {\n constructor(\n observerOrNext?: Partial> | ((value: T) => void) | null,\n error?: ((e?: any) => void) | null,\n complete?: (() => void) | null\n ) {\n super();\n\n let partialObserver: Partial>;\n if (isFunction(observerOrNext) || !observerOrNext) {\n // The first argument is a function, not an observer. The next\n // two arguments *could* be observers, or they could be empty.\n partialObserver = {\n next: (observerOrNext ?? undefined) as (((value: T) => void) | undefined),\n error: error ?? undefined,\n complete: complete ?? undefined,\n };\n } else {\n // The first argument is a partial observer.\n let context: any;\n if (this && config.useDeprecatedNextContext) {\n // This is a deprecated path that made `this.unsubscribe()` available in\n // next handler functions passed to subscribe. This only exists behind a flag\n // now, as it is *very* slow.\n context = Object.create(observerOrNext);\n context.unsubscribe = () => this.unsubscribe();\n partialObserver = {\n next: observerOrNext.next && bind(observerOrNext.next, context),\n error: observerOrNext.error && bind(observerOrNext.error, context),\n complete: observerOrNext.complete && bind(observerOrNext.complete, context),\n };\n } else {\n // The \"normal\" path. Just use the partial observer directly.\n partialObserver = observerOrNext;\n }\n }\n\n // Wrap the partial observer to ensure it's a full observer, and\n // make sure proper error handling is accounted for.\n this.destination = new ConsumerObserver(partialObserver);\n }\n}\n\nfunction handleUnhandledError(error: any) {\n if (config.useDeprecatedSynchronousErrorHandling) {\n captureError(error);\n } else {\n // Ideal path, we report this as an unhandled error,\n // which is thrown on a new call stack.\n reportUnhandledError(error);\n }\n}\n\n/**\n * An error handler used when no error handler was supplied\n * to the SafeSubscriber -- meaning no error handler was supplied\n * do the `subscribe` call on our observable.\n * @param err The error to handle\n */\nfunction defaultErrorHandler(err: any) {\n throw err;\n}\n\n/**\n * A handler for notifications that cannot be sent to a stopped subscriber.\n * @param notification The notification being sent\n * @param subscriber The stopped subscriber\n */\nfunction handleStoppedNotification(notification: ObservableNotification, subscriber: Subscriber) {\n const { onStoppedNotification } = config;\n onStoppedNotification && timeoutProvider.setTimeout(() => onStoppedNotification(notification, subscriber));\n}\n\n/**\n * The observer used as a stub for subscriptions where the user did not\n * pass any arguments to `subscribe`. Comes with the default error handling\n * behavior.\n */\nexport const EMPTY_OBSERVER: Readonly> & { closed: true } = {\n closed: true,\n next: noop,\n error: defaultErrorHandler,\n complete: noop,\n};\n", "/**\n * Symbol.observable or a string \"@@observable\". Used for interop\n *\n * @deprecated We will no longer be exporting this symbol in upcoming versions of RxJS.\n * Instead polyfill and use Symbol.observable directly *or* use https://www.npmjs.com/package/symbol-observable\n */\nexport const observable: string | symbol = (() => (typeof Symbol === 'function' && Symbol.observable) || '@@observable')();\n", "/**\n * This function takes one parameter and just returns it. Simply put,\n * this is like `(x: T): T => x`.\n *\n * ## Examples\n *\n * This is useful in some cases when using things like `mergeMap`\n *\n * ```ts\n * import { interval, take, map, range, mergeMap, identity } from 'rxjs';\n *\n * const source$ = interval(1000).pipe(take(5));\n *\n * const result$ = source$.pipe(\n * map(i => range(i)),\n * mergeMap(identity) // same as mergeMap(x => x)\n * );\n *\n * result$.subscribe({\n * next: console.log\n * });\n * ```\n *\n * Or when you want to selectively apply an operator\n *\n * ```ts\n * import { interval, take, identity } from 'rxjs';\n *\n * const shouldLimit = () => Math.random() < 0.5;\n *\n * const source$ = interval(1000);\n *\n * const result$ = source$.pipe(shouldLimit() ? take(5) : identity);\n *\n * result$.subscribe({\n * next: console.log\n * });\n * ```\n *\n * @param x Any value that is returned by this function\n * @returns The value passed as the first parameter to this function\n */\nexport function identity(x: T): T {\n return x;\n}\n", "import { identity } from './identity';\nimport { UnaryFunction } from '../types';\n\nexport function pipe(): typeof identity;\nexport function pipe(fn1: UnaryFunction): UnaryFunction;\nexport function pipe(fn1: UnaryFunction, fn2: UnaryFunction): UnaryFunction;\nexport function pipe(fn1: UnaryFunction, fn2: UnaryFunction, fn3: UnaryFunction): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction,\n fn9: UnaryFunction\n): UnaryFunction;\nexport function pipe(\n fn1: UnaryFunction,\n fn2: UnaryFunction,\n fn3: UnaryFunction,\n fn4: UnaryFunction,\n fn5: UnaryFunction,\n fn6: UnaryFunction,\n fn7: UnaryFunction,\n fn8: UnaryFunction,\n fn9: UnaryFunction,\n ...fns: UnaryFunction[]\n): UnaryFunction;\n\n/**\n * pipe() can be called on one or more functions, each of which can take one argument (\"UnaryFunction\")\n * and uses it to return a value.\n * It returns a function that takes one argument, passes it to the first UnaryFunction, and then\n * passes the result to the next one, passes that result to the next one, and so on. \n */\nexport function pipe(...fns: Array>): UnaryFunction {\n return pipeFromArray(fns);\n}\n\n/** @internal */\nexport function pipeFromArray(fns: Array>): UnaryFunction {\n if (fns.length === 0) {\n return identity as UnaryFunction;\n }\n\n if (fns.length === 1) {\n return fns[0];\n }\n\n return function piped(input: T): R {\n return fns.reduce((prev: any, fn: UnaryFunction) => fn(prev), input as any);\n };\n}\n", "import { Operator } from './Operator';\nimport { SafeSubscriber, Subscriber } from './Subscriber';\nimport { isSubscription, Subscription } from './Subscription';\nimport { TeardownLogic, OperatorFunction, Subscribable, Observer } from './types';\nimport { observable as Symbol_observable } from './symbol/observable';\nimport { pipeFromArray } from './util/pipe';\nimport { config } from './config';\nimport { isFunction } from './util/isFunction';\nimport { errorContext } from './util/errorContext';\n\n/**\n * A representation of any set of values over any amount of time. This is the most basic building block\n * of RxJS.\n *\n * @class Observable\n */\nexport class Observable implements Subscribable {\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n */\n source: Observable | undefined;\n\n /**\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n */\n operator: Operator | undefined;\n\n /**\n * @constructor\n * @param {Function} subscribe the function that is called when the Observable is\n * initially subscribed to. This function is given a Subscriber, to which new values\n * can be `next`ed, or an `error` method can be called to raise an error, or\n * `complete` can be called to notify of a successful completion.\n */\n constructor(subscribe?: (this: Observable, subscriber: Subscriber) => TeardownLogic) {\n if (subscribe) {\n this._subscribe = subscribe;\n }\n }\n\n // HACK: Since TypeScript inherits static properties too, we have to\n // fight against TypeScript here so Subject can have a different static create signature\n /**\n * Creates a new Observable by calling the Observable constructor\n * @owner Observable\n * @method create\n * @param {Function} subscribe? the subscriber function to be passed to the Observable constructor\n * @return {Observable} a new observable\n * @nocollapse\n * @deprecated Use `new Observable()` instead. Will be removed in v8.\n */\n static create: (...args: any[]) => any = (subscribe?: (subscriber: Subscriber) => TeardownLogic) => {\n return new Observable(subscribe);\n };\n\n /**\n * Creates a new Observable, with this Observable instance as the source, and the passed\n * operator defined as the new observable's operator.\n * @method lift\n * @param operator the operator defining the operation to take on the observable\n * @return a new observable with the Operator applied\n * @deprecated Internal implementation detail, do not use directly. Will be made internal in v8.\n * If you have implemented an operator using `lift`, it is recommended that you create an\n * operator by simply returning `new Observable()` directly. See \"Creating new operators from\n * scratch\" section here: https://rxjs.dev/guide/operators\n */\n lift(operator?: Operator): Observable {\n const observable = new Observable();\n observable.source = this;\n observable.operator = operator;\n return observable;\n }\n\n subscribe(observerOrNext?: Partial> | ((value: T) => void)): Subscription;\n /** @deprecated Instead of passing separate callback arguments, use an observer argument. Signatures taking separate callback arguments will be removed in v8. Details: https://rxjs.dev/deprecations/subscribe-arguments */\n subscribe(next?: ((value: T) => void) | null, error?: ((error: any) => void) | null, complete?: (() => void) | null): Subscription;\n /**\n * Invokes an execution of an Observable and registers Observer handlers for notifications it will emit.\n *\n * Use it when you have all these Observables, but still nothing is happening.\n *\n * `subscribe` is not a regular operator, but a method that calls Observable's internal `subscribe` function. It\n * might be for example a function that you passed to Observable's constructor, but most of the time it is\n * a library implementation, which defines what will be emitted by an Observable, and when it be will emitted. This means\n * that calling `subscribe` is actually the moment when Observable starts its work, not when it is created, as it is often\n * the thought.\n *\n * Apart from starting the execution of an Observable, this method allows you to listen for values\n * that an Observable emits, as well as for when it completes or errors. You can achieve this in two\n * of the following ways.\n *\n * The first way is creating an object that implements {@link Observer} interface. It should have methods\n * defined by that interface, but note that it should be just a regular JavaScript object, which you can create\n * yourself in any way you want (ES6 class, classic function constructor, object literal etc.). In particular, do\n * not attempt to use any RxJS implementation details to create Observers - you don't need them. Remember also\n * that your object does not have to implement all methods. If you find yourself creating a method that doesn't\n * do anything, you can simply omit it. Note however, if the `error` method is not provided and an error happens,\n * it will be thrown asynchronously. Errors thrown asynchronously cannot be caught using `try`/`catch`. Instead,\n * use the {@link onUnhandledError} configuration option or use a runtime handler (like `window.onerror` or\n * `process.on('error)`) to be notified of unhandled errors. Because of this, it's recommended that you provide\n * an `error` method to avoid missing thrown errors.\n *\n * The second way is to give up on Observer object altogether and simply provide callback functions in place of its methods.\n * This means you can provide three functions as arguments to `subscribe`, where the first function is equivalent\n * of a `next` method, the second of an `error` method and the third of a `complete` method. Just as in case of an Observer,\n * if you do not need to listen for something, you can omit a function by passing `undefined` or `null`,\n * since `subscribe` recognizes these functions by where they were placed in function call. When it comes\n * to the `error` function, as with an Observer, if not provided, errors emitted by an Observable will be thrown asynchronously.\n *\n * You can, however, subscribe with no parameters at all. This may be the case where you're not interested in terminal events\n * and you also handled emissions internally by using operators (e.g. using `tap`).\n *\n * Whichever style of calling `subscribe` you use, in both cases it returns a Subscription object.\n * This object allows you to call `unsubscribe` on it, which in turn will stop the work that an Observable does and will clean\n * up all resources that an Observable used. Note that cancelling a subscription will not call `complete` callback\n * provided to `subscribe` function, which is reserved for a regular completion signal that comes from an Observable.\n *\n * Remember that callbacks provided to `subscribe` are not guaranteed to be called asynchronously.\n * It is an Observable itself that decides when these functions will be called. For example {@link of}\n * by default emits all its values synchronously. Always check documentation for how given Observable\n * will behave when subscribed and if its default behavior can be modified with a `scheduler`.\n *\n * #### Examples\n *\n * Subscribe with an {@link guide/observer Observer}\n *\n * ```ts\n * import { of } from 'rxjs';\n *\n * const sumObserver = {\n * sum: 0,\n * next(value) {\n * console.log('Adding: ' + value);\n * this.sum = this.sum + value;\n * },\n * error() {\n * // We actually could just remove this method,\n * // since we do not really care about errors right now.\n * },\n * complete() {\n * console.log('Sum equals: ' + this.sum);\n * }\n * };\n *\n * of(1, 2, 3) // Synchronously emits 1, 2, 3 and then completes.\n * .subscribe(sumObserver);\n *\n * // Logs:\n * // 'Adding: 1'\n * // 'Adding: 2'\n * // 'Adding: 3'\n * // 'Sum equals: 6'\n * ```\n *\n * Subscribe with functions ({@link deprecations/subscribe-arguments deprecated})\n *\n * ```ts\n * import { of } from 'rxjs'\n *\n * let sum = 0;\n *\n * of(1, 2, 3).subscribe(\n * value => {\n * console.log('Adding: ' + value);\n * sum = sum + value;\n * },\n * undefined,\n * () => console.log('Sum equals: ' + sum)\n * );\n *\n * // Logs:\n * // 'Adding: 1'\n * // 'Adding: 2'\n * // 'Adding: 3'\n * // 'Sum equals: 6'\n * ```\n *\n * Cancel a subscription\n *\n * ```ts\n * import { interval } from 'rxjs';\n *\n * const subscription = interval(1000).subscribe({\n * next(num) {\n * console.log(num)\n * },\n * complete() {\n * // Will not be called, even when cancelling subscription.\n * console.log('completed!');\n * }\n * });\n *\n * setTimeout(() => {\n * subscription.unsubscribe();\n * console.log('unsubscribed!');\n * }, 2500);\n *\n * // Logs:\n * // 0 after 1s\n * // 1 after 2s\n * // 'unsubscribed!' after 2.5s\n * ```\n *\n * @param {Observer|Function} observerOrNext (optional) Either an observer with methods to be called,\n * or the first of three possible handlers, which is the handler for each value emitted from the subscribed\n * Observable.\n * @param {Function} error (optional) A handler for a terminal event resulting from an error. If no error handler is provided,\n * the error will be thrown asynchronously as unhandled.\n * @param {Function} complete (optional) A handler for a terminal event resulting from successful completion.\n * @return {Subscription} a subscription reference to the registered handlers\n * @method subscribe\n */\n subscribe(\n observerOrNext?: Partial> | ((value: T) => void) | null,\n error?: ((error: any) => void) | null,\n complete?: (() => void) | null\n ): Subscription {\n const subscriber = isSubscriber(observerOrNext) ? observerOrNext : new SafeSubscriber(observerOrNext, error, complete);\n\n errorContext(() => {\n const { operator, source } = this;\n subscriber.add(\n operator\n ? // We're dealing with a subscription in the\n // operator chain to one of our lifted operators.\n operator.call(subscriber, source)\n : source\n ? // If `source` has a value, but `operator` does not, something that\n // had intimate knowledge of our API, like our `Subject`, must have\n // set it. We're going to just call `_subscribe` directly.\n this._subscribe(subscriber)\n : // In all other cases, we're likely wrapping a user-provided initializer\n // function, so we need to catch errors and handle them appropriately.\n this._trySubscribe(subscriber)\n );\n });\n\n return subscriber;\n }\n\n /** @internal */\n protected _trySubscribe(sink: Subscriber): TeardownLogic {\n try {\n return this._subscribe(sink);\n } catch (err) {\n // We don't need to return anything in this case,\n // because it's just going to try to `add()` to a subscription\n // above.\n sink.error(err);\n }\n }\n\n /**\n * Used as a NON-CANCELLABLE means of subscribing to an observable, for use with\n * APIs that expect promises, like `async/await`. You cannot unsubscribe from this.\n *\n * **WARNING**: Only use this with observables you *know* will complete. If the source\n * observable does not complete, you will end up with a promise that is hung up, and\n * potentially all of the state of an async function hanging out in memory. To avoid\n * this situation, look into adding something like {@link timeout}, {@link take},\n * {@link takeWhile}, or {@link takeUntil} amongst others.\n *\n * #### Example\n *\n * ```ts\n * import { interval, take } from 'rxjs';\n *\n * const source$ = interval(1000).pipe(take(4));\n *\n * async function getTotal() {\n * let total = 0;\n *\n * await source$.forEach(value => {\n * total += value;\n * console.log('observable -> ' + value);\n * });\n *\n * return total;\n * }\n *\n * getTotal().then(\n * total => console.log('Total: ' + total)\n * );\n *\n * // Expected:\n * // 'observable -> 0'\n * // 'observable -> 1'\n * // 'observable -> 2'\n * // 'observable -> 3'\n * // 'Total: 6'\n * ```\n *\n * @param next a handler for each value emitted by the observable\n * @return a promise that either resolves on observable completion or\n * rejects with the handled error\n */\n forEach(next: (value: T) => void): Promise;\n\n /**\n * @param next a handler for each value emitted by the observable\n * @param promiseCtor a constructor function used to instantiate the Promise\n * @return a promise that either resolves on observable completion or\n * rejects with the handled error\n * @deprecated Passing a Promise constructor will no longer be available\n * in upcoming versions of RxJS. This is because it adds weight to the library, for very\n * little benefit. If you need this functionality, it is recommended that you either\n * polyfill Promise, or you create an adapter to convert the returned native promise\n * to whatever promise implementation you wanted. Will be removed in v8.\n */\n forEach(next: (value: T) => void, promiseCtor: PromiseConstructorLike): Promise;\n\n forEach(next: (value: T) => void, promiseCtor?: PromiseConstructorLike): Promise {\n promiseCtor = getPromiseCtor(promiseCtor);\n\n return new promiseCtor((resolve, reject) => {\n const subscriber = new SafeSubscriber({\n next: (value) => {\n try {\n next(value);\n } catch (err) {\n reject(err);\n subscriber.unsubscribe();\n }\n },\n error: reject,\n complete: resolve,\n });\n this.subscribe(subscriber);\n }) as Promise;\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): TeardownLogic {\n return this.source?.subscribe(subscriber);\n }\n\n /**\n * An interop point defined by the es7-observable spec https://github.com/zenparsing/es-observable\n * @method Symbol.observable\n * @return {Observable} this instance of the observable\n */\n [Symbol_observable]() {\n return this;\n }\n\n /* tslint:disable:max-line-length */\n pipe(): Observable;\n pipe(op1: OperatorFunction): Observable;\n pipe(op1: OperatorFunction, op2: OperatorFunction): Observable;\n pipe(op1: OperatorFunction, op2: OperatorFunction, op3: OperatorFunction): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction,\n op9: OperatorFunction\n ): Observable;\n pipe(\n op1: OperatorFunction,\n op2: OperatorFunction,\n op3: OperatorFunction,\n op4: OperatorFunction,\n op5: OperatorFunction,\n op6: OperatorFunction,\n op7: OperatorFunction,\n op8: OperatorFunction,\n op9: OperatorFunction,\n ...operations: OperatorFunction[]\n ): Observable;\n /* tslint:enable:max-line-length */\n\n /**\n * Used to stitch together functional operators into a chain.\n * @method pipe\n * @return {Observable} the Observable result of all of the operators having\n * been called in the order they were passed in.\n *\n * ## Example\n *\n * ```ts\n * import { interval, filter, map, scan } from 'rxjs';\n *\n * interval(1000)\n * .pipe(\n * filter(x => x % 2 === 0),\n * map(x => x + x),\n * scan((acc, x) => acc + x)\n * )\n * .subscribe(x => console.log(x));\n * ```\n */\n pipe(...operations: OperatorFunction[]): Observable {\n return pipeFromArray(operations)(this);\n }\n\n /* tslint:disable:max-line-length */\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(): Promise;\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(PromiseCtor: typeof Promise): Promise;\n /** @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise */\n toPromise(PromiseCtor: PromiseConstructorLike): Promise;\n /* tslint:enable:max-line-length */\n\n /**\n * Subscribe to this Observable and get a Promise resolving on\n * `complete` with the last emission (if any).\n *\n * **WARNING**: Only use this with observables you *know* will complete. If the source\n * observable does not complete, you will end up with a promise that is hung up, and\n * potentially all of the state of an async function hanging out in memory. To avoid\n * this situation, look into adding something like {@link timeout}, {@link take},\n * {@link takeWhile}, or {@link takeUntil} amongst others.\n *\n * @method toPromise\n * @param [promiseCtor] a constructor function used to instantiate\n * the Promise\n * @return A Promise that resolves with the last value emit, or\n * rejects on an error. If there were no emissions, Promise\n * resolves with undefined.\n * @deprecated Replaced with {@link firstValueFrom} and {@link lastValueFrom}. Will be removed in v8. Details: https://rxjs.dev/deprecations/to-promise\n */\n toPromise(promiseCtor?: PromiseConstructorLike): Promise {\n promiseCtor = getPromiseCtor(promiseCtor);\n\n return new promiseCtor((resolve, reject) => {\n let value: T | undefined;\n this.subscribe(\n (x: T) => (value = x),\n (err: any) => reject(err),\n () => resolve(value)\n );\n }) as Promise;\n }\n}\n\n/**\n * Decides between a passed promise constructor from consuming code,\n * A default configured promise constructor, and the native promise\n * constructor and returns it. If nothing can be found, it will throw\n * an error.\n * @param promiseCtor The optional promise constructor to passed by consuming code\n */\nfunction getPromiseCtor(promiseCtor: PromiseConstructorLike | undefined) {\n return promiseCtor ?? config.Promise ?? Promise;\n}\n\nfunction isObserver(value: any): value is Observer {\n return value && isFunction(value.next) && isFunction(value.error) && isFunction(value.complete);\n}\n\nfunction isSubscriber(value: any): value is Subscriber {\n return (value && value instanceof Subscriber) || (isObserver(value) && isSubscription(value));\n}\n", "import { Observable } from '../Observable';\nimport { Subscriber } from '../Subscriber';\nimport { OperatorFunction } from '../types';\nimport { isFunction } from './isFunction';\n\n/**\n * Used to determine if an object is an Observable with a lift function.\n */\nexport function hasLift(source: any): source is { lift: InstanceType['lift'] } {\n return isFunction(source?.lift);\n}\n\n/**\n * Creates an `OperatorFunction`. Used to define operators throughout the library in a concise way.\n * @param init The logic to connect the liftedSource to the subscriber at the moment of subscription.\n */\nexport function operate(\n init: (liftedSource: Observable, subscriber: Subscriber) => (() => void) | void\n): OperatorFunction {\n return (source: Observable) => {\n if (hasLift(source)) {\n return source.lift(function (this: Subscriber, liftedSource: Observable) {\n try {\n return init(liftedSource, this);\n } catch (err) {\n this.error(err);\n }\n });\n }\n throw new TypeError('Unable to lift unknown Observable type');\n };\n}\n", "import { Subscriber } from '../Subscriber';\n\n/**\n * Creates an instance of an `OperatorSubscriber`.\n * @param destination The downstream subscriber.\n * @param onNext Handles next values, only called if this subscriber is not stopped or closed. Any\n * error that occurs in this function is caught and sent to the `error` method of this subscriber.\n * @param onError Handles errors from the subscription, any errors that occur in this handler are caught\n * and send to the `destination` error handler.\n * @param onComplete Handles completion notification from the subscription. Any errors that occur in\n * this handler are sent to the `destination` error handler.\n * @param onFinalize Additional teardown logic here. This will only be called on teardown if the\n * subscriber itself is not already closed. This is called after all other teardown logic is executed.\n */\nexport function createOperatorSubscriber(\n destination: Subscriber,\n onNext?: (value: T) => void,\n onComplete?: () => void,\n onError?: (err: any) => void,\n onFinalize?: () => void\n): Subscriber {\n return new OperatorSubscriber(destination, onNext, onComplete, onError, onFinalize);\n}\n\n/**\n * A generic helper for allowing operators to be created with a Subscriber and\n * use closures to capture necessary state from the operator function itself.\n */\nexport class OperatorSubscriber extends Subscriber {\n /**\n * Creates an instance of an `OperatorSubscriber`.\n * @param destination The downstream subscriber.\n * @param onNext Handles next values, only called if this subscriber is not stopped or closed. Any\n * error that occurs in this function is caught and sent to the `error` method of this subscriber.\n * @param onError Handles errors from the subscription, any errors that occur in this handler are caught\n * and send to the `destination` error handler.\n * @param onComplete Handles completion notification from the subscription. Any errors that occur in\n * this handler are sent to the `destination` error handler.\n * @param onFinalize Additional finalization logic here. This will only be called on finalization if the\n * subscriber itself is not already closed. This is called after all other finalization logic is executed.\n * @param shouldUnsubscribe An optional check to see if an unsubscribe call should truly unsubscribe.\n * NOTE: This currently **ONLY** exists to support the strange behavior of {@link groupBy}, where unsubscription\n * to the resulting observable does not actually disconnect from the source if there are active subscriptions\n * to any grouped observable. (DO NOT EXPOSE OR USE EXTERNALLY!!!)\n */\n constructor(\n destination: Subscriber,\n onNext?: (value: T) => void,\n onComplete?: () => void,\n onError?: (err: any) => void,\n private onFinalize?: () => void,\n private shouldUnsubscribe?: () => boolean\n ) {\n // It's important - for performance reasons - that all of this class's\n // members are initialized and that they are always initialized in the same\n // order. This will ensure that all OperatorSubscriber instances have the\n // same hidden class in V8. This, in turn, will help keep the number of\n // hidden classes involved in property accesses within the base class as\n // low as possible. If the number of hidden classes involved exceeds four,\n // the property accesses will become megamorphic and performance penalties\n // will be incurred - i.e. inline caches won't be used.\n //\n // The reasons for ensuring all instances have the same hidden class are\n // further discussed in this blog post from Benedikt Meurer:\n // https://benediktmeurer.de/2018/03/23/impact-of-polymorphism-on-component-based-frameworks-like-react/\n super(destination);\n this._next = onNext\n ? function (this: OperatorSubscriber, value: T) {\n try {\n onNext(value);\n } catch (err) {\n destination.error(err);\n }\n }\n : super._next;\n this._error = onError\n ? function (this: OperatorSubscriber, err: any) {\n try {\n onError(err);\n } catch (err) {\n // Send any errors that occur down stream.\n destination.error(err);\n } finally {\n // Ensure finalization.\n this.unsubscribe();\n }\n }\n : super._error;\n this._complete = onComplete\n ? function (this: OperatorSubscriber) {\n try {\n onComplete();\n } catch (err) {\n // Send any errors that occur down stream.\n destination.error(err);\n } finally {\n // Ensure finalization.\n this.unsubscribe();\n }\n }\n : super._complete;\n }\n\n unsubscribe() {\n if (!this.shouldUnsubscribe || this.shouldUnsubscribe()) {\n const { closed } = this;\n super.unsubscribe();\n // Execute additional teardown if we have any and we didn't already do so.\n !closed && this.onFinalize?.();\n }\n }\n}\n", "import { Subscription } from '../Subscription';\n\ninterface AnimationFrameProvider {\n schedule(callback: FrameRequestCallback): Subscription;\n requestAnimationFrame: typeof requestAnimationFrame;\n cancelAnimationFrame: typeof cancelAnimationFrame;\n delegate:\n | {\n requestAnimationFrame: typeof requestAnimationFrame;\n cancelAnimationFrame: typeof cancelAnimationFrame;\n }\n | undefined;\n}\n\nexport const animationFrameProvider: AnimationFrameProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n schedule(callback) {\n let request = requestAnimationFrame;\n let cancel: typeof cancelAnimationFrame | undefined = cancelAnimationFrame;\n const { delegate } = animationFrameProvider;\n if (delegate) {\n request = delegate.requestAnimationFrame;\n cancel = delegate.cancelAnimationFrame;\n }\n const handle = request((timestamp) => {\n // Clear the cancel function. The request has been fulfilled, so\n // attempting to cancel the request upon unsubscription would be\n // pointless.\n cancel = undefined;\n callback(timestamp);\n });\n return new Subscription(() => cancel?.(handle));\n },\n requestAnimationFrame(...args) {\n const { delegate } = animationFrameProvider;\n return (delegate?.requestAnimationFrame || requestAnimationFrame)(...args);\n },\n cancelAnimationFrame(...args) {\n const { delegate } = animationFrameProvider;\n return (delegate?.cancelAnimationFrame || cancelAnimationFrame)(...args);\n },\n delegate: undefined,\n};\n", "import { createErrorClass } from './createErrorClass';\n\nexport interface ObjectUnsubscribedError extends Error {}\n\nexport interface ObjectUnsubscribedErrorCtor {\n /**\n * @deprecated Internal implementation detail. Do not construct error instances.\n * Cannot be tagged as internal: https://github.com/ReactiveX/rxjs/issues/6269\n */\n new (): ObjectUnsubscribedError;\n}\n\n/**\n * An error thrown when an action is invalid because the object has been\n * unsubscribed.\n *\n * @see {@link Subject}\n * @see {@link BehaviorSubject}\n *\n * @class ObjectUnsubscribedError\n */\nexport const ObjectUnsubscribedError: ObjectUnsubscribedErrorCtor = createErrorClass(\n (_super) =>\n function ObjectUnsubscribedErrorImpl(this: any) {\n _super(this);\n this.name = 'ObjectUnsubscribedError';\n this.message = 'object unsubscribed';\n }\n);\n", "import { Operator } from './Operator';\nimport { Observable } from './Observable';\nimport { Subscriber } from './Subscriber';\nimport { Subscription, EMPTY_SUBSCRIPTION } from './Subscription';\nimport { Observer, SubscriptionLike, TeardownLogic } from './types';\nimport { ObjectUnsubscribedError } from './util/ObjectUnsubscribedError';\nimport { arrRemove } from './util/arrRemove';\nimport { errorContext } from './util/errorContext';\n\n/**\n * A Subject is a special type of Observable that allows values to be\n * multicasted to many Observers. Subjects are like EventEmitters.\n *\n * Every Subject is an Observable and an Observer. You can subscribe to a\n * Subject, and you can call next to feed values as well as error and complete.\n */\nexport class Subject extends Observable implements SubscriptionLike {\n closed = false;\n\n private currentObservers: Observer[] | null = null;\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n observers: Observer[] = [];\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n isStopped = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n hasError = false;\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n thrownError: any = null;\n\n /**\n * Creates a \"subject\" by basically gluing an observer to an observable.\n *\n * @nocollapse\n * @deprecated Recommended you do not use. Will be removed at some point in the future. Plans for replacement still under discussion.\n */\n static create: (...args: any[]) => any = (destination: Observer, source: Observable): AnonymousSubject => {\n return new AnonymousSubject(destination, source);\n };\n\n constructor() {\n // NOTE: This must be here to obscure Observable's constructor.\n super();\n }\n\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n lift(operator: Operator): Observable {\n const subject = new AnonymousSubject(this, this);\n subject.operator = operator as any;\n return subject as any;\n }\n\n /** @internal */\n protected _throwIfClosed() {\n if (this.closed) {\n throw new ObjectUnsubscribedError();\n }\n }\n\n next(value: T) {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n if (!this.currentObservers) {\n this.currentObservers = Array.from(this.observers);\n }\n for (const observer of this.currentObservers) {\n observer.next(value);\n }\n }\n });\n }\n\n error(err: any) {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n this.hasError = this.isStopped = true;\n this.thrownError = err;\n const { observers } = this;\n while (observers.length) {\n observers.shift()!.error(err);\n }\n }\n });\n }\n\n complete() {\n errorContext(() => {\n this._throwIfClosed();\n if (!this.isStopped) {\n this.isStopped = true;\n const { observers } = this;\n while (observers.length) {\n observers.shift()!.complete();\n }\n }\n });\n }\n\n unsubscribe() {\n this.isStopped = this.closed = true;\n this.observers = this.currentObservers = null!;\n }\n\n get observed() {\n return this.observers?.length > 0;\n }\n\n /** @internal */\n protected _trySubscribe(subscriber: Subscriber): TeardownLogic {\n this._throwIfClosed();\n return super._trySubscribe(subscriber);\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n this._throwIfClosed();\n this._checkFinalizedStatuses(subscriber);\n return this._innerSubscribe(subscriber);\n }\n\n /** @internal */\n protected _innerSubscribe(subscriber: Subscriber) {\n const { hasError, isStopped, observers } = this;\n if (hasError || isStopped) {\n return EMPTY_SUBSCRIPTION;\n }\n this.currentObservers = null;\n observers.push(subscriber);\n return new Subscription(() => {\n this.currentObservers = null;\n arrRemove(observers, subscriber);\n });\n }\n\n /** @internal */\n protected _checkFinalizedStatuses(subscriber: Subscriber) {\n const { hasError, thrownError, isStopped } = this;\n if (hasError) {\n subscriber.error(thrownError);\n } else if (isStopped) {\n subscriber.complete();\n }\n }\n\n /**\n * Creates a new Observable with this Subject as the source. You can do this\n * to create custom Observer-side logic of the Subject and conceal it from\n * code that uses the Observable.\n * @return {Observable} Observable that the Subject casts to\n */\n asObservable(): Observable {\n const observable: any = new Observable();\n observable.source = this;\n return observable;\n }\n}\n\n/**\n * @class AnonymousSubject\n */\nexport class AnonymousSubject extends Subject {\n constructor(\n /** @deprecated Internal implementation detail, do not use directly. Will be made internal in v8. */\n public destination?: Observer,\n source?: Observable\n ) {\n super();\n this.source = source;\n }\n\n next(value: T) {\n this.destination?.next?.(value);\n }\n\n error(err: any) {\n this.destination?.error?.(err);\n }\n\n complete() {\n this.destination?.complete?.();\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n return this.source?.subscribe(subscriber) ?? EMPTY_SUBSCRIPTION;\n }\n}\n", "import { Subject } from './Subject';\nimport { Subscriber } from './Subscriber';\nimport { Subscription } from './Subscription';\n\n/**\n * A variant of Subject that requires an initial value and emits its current\n * value whenever it is subscribed to.\n *\n * @class BehaviorSubject\n */\nexport class BehaviorSubject extends Subject {\n constructor(private _value: T) {\n super();\n }\n\n get value(): T {\n return this.getValue();\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n const subscription = super._subscribe(subscriber);\n !subscription.closed && subscriber.next(this._value);\n return subscription;\n }\n\n getValue(): T {\n const { hasError, thrownError, _value } = this;\n if (hasError) {\n throw thrownError;\n }\n this._throwIfClosed();\n return _value;\n }\n\n next(value: T): void {\n super.next((this._value = value));\n }\n}\n", "import { TimestampProvider } from '../types';\n\ninterface DateTimestampProvider extends TimestampProvider {\n delegate: TimestampProvider | undefined;\n}\n\nexport const dateTimestampProvider: DateTimestampProvider = {\n now() {\n // Use the variable rather than `this` so that the function can be called\n // without being bound to the provider.\n return (dateTimestampProvider.delegate || Date).now();\n },\n delegate: undefined,\n};\n", "import { Subject } from './Subject';\nimport { TimestampProvider } from './types';\nimport { Subscriber } from './Subscriber';\nimport { Subscription } from './Subscription';\nimport { dateTimestampProvider } from './scheduler/dateTimestampProvider';\n\n/**\n * A variant of {@link Subject} that \"replays\" old values to new subscribers by emitting them when they first subscribe.\n *\n * `ReplaySubject` has an internal buffer that will store a specified number of values that it has observed. Like `Subject`,\n * `ReplaySubject` \"observes\" values by having them passed to its `next` method. When it observes a value, it will store that\n * value for a time determined by the configuration of the `ReplaySubject`, as passed to its constructor.\n *\n * When a new subscriber subscribes to the `ReplaySubject` instance, it will synchronously emit all values in its buffer in\n * a First-In-First-Out (FIFO) manner. The `ReplaySubject` will also complete, if it has observed completion; and it will\n * error if it has observed an error.\n *\n * There are two main configuration items to be concerned with:\n *\n * 1. `bufferSize` - This will determine how many items are stored in the buffer, defaults to infinite.\n * 2. `windowTime` - The amount of time to hold a value in the buffer before removing it from the buffer.\n *\n * Both configurations may exist simultaneously. So if you would like to buffer a maximum of 3 values, as long as the values\n * are less than 2 seconds old, you could do so with a `new ReplaySubject(3, 2000)`.\n *\n * ### Differences with BehaviorSubject\n *\n * `BehaviorSubject` is similar to `new ReplaySubject(1)`, with a couple of exceptions:\n *\n * 1. `BehaviorSubject` comes \"primed\" with a single value upon construction.\n * 2. `ReplaySubject` will replay values, even after observing an error, where `BehaviorSubject` will not.\n *\n * @see {@link Subject}\n * @see {@link BehaviorSubject}\n * @see {@link shareReplay}\n */\nexport class ReplaySubject extends Subject {\n private _buffer: (T | number)[] = [];\n private _infiniteTimeWindow = true;\n\n /**\n * @param bufferSize The size of the buffer to replay on subscription\n * @param windowTime The amount of time the buffered items will stay buffered\n * @param timestampProvider An object with a `now()` method that provides the current timestamp. This is used to\n * calculate the amount of time something has been buffered.\n */\n constructor(\n private _bufferSize = Infinity,\n private _windowTime = Infinity,\n private _timestampProvider: TimestampProvider = dateTimestampProvider\n ) {\n super();\n this._infiniteTimeWindow = _windowTime === Infinity;\n this._bufferSize = Math.max(1, _bufferSize);\n this._windowTime = Math.max(1, _windowTime);\n }\n\n next(value: T): void {\n const { isStopped, _buffer, _infiniteTimeWindow, _timestampProvider, _windowTime } = this;\n if (!isStopped) {\n _buffer.push(value);\n !_infiniteTimeWindow && _buffer.push(_timestampProvider.now() + _windowTime);\n }\n this._trimBuffer();\n super.next(value);\n }\n\n /** @internal */\n protected _subscribe(subscriber: Subscriber): Subscription {\n this._throwIfClosed();\n this._trimBuffer();\n\n const subscription = this._innerSubscribe(subscriber);\n\n const { _infiniteTimeWindow, _buffer } = this;\n // We use a copy here, so reentrant code does not mutate our array while we're\n // emitting it to a new subscriber.\n const copy = _buffer.slice();\n for (let i = 0; i < copy.length && !subscriber.closed; i += _infiniteTimeWindow ? 1 : 2) {\n subscriber.next(copy[i] as T);\n }\n\n this._checkFinalizedStatuses(subscriber);\n\n return subscription;\n }\n\n private _trimBuffer() {\n const { _bufferSize, _timestampProvider, _buffer, _infiniteTimeWindow } = this;\n // If we don't have an infinite buffer size, and we're over the length,\n // use splice to truncate the old buffer values off. Note that we have to\n // double the size for instances where we're not using an infinite time window\n // because we're storing the values and the timestamps in the same array.\n const adjustedBufferSize = (_infiniteTimeWindow ? 1 : 2) * _bufferSize;\n _bufferSize < Infinity && adjustedBufferSize < _buffer.length && _buffer.splice(0, _buffer.length - adjustedBufferSize);\n\n // Now, if we're not in an infinite time window, remove all values where the time is\n // older than what is allowed.\n if (!_infiniteTimeWindow) {\n const now = _timestampProvider.now();\n let last = 0;\n // Search the array for the first timestamp that isn't expired and\n // truncate the buffer up to that point.\n for (let i = 1; i < _buffer.length && (_buffer[i] as number) <= now; i += 2) {\n last = i;\n }\n last && _buffer.splice(0, last + 1);\n }\n }\n}\n", "import { Scheduler } from '../Scheduler';\nimport { Subscription } from '../Subscription';\nimport { SchedulerAction } from '../types';\n\n/**\n * A unit of work to be executed in a `scheduler`. An action is typically\n * created from within a {@link SchedulerLike} and an RxJS user does not need to concern\n * themselves about creating and manipulating an Action.\n *\n * ```ts\n * class Action extends Subscription {\n * new (scheduler: Scheduler, work: (state?: T) => void);\n * schedule(state?: T, delay: number = 0): Subscription;\n * }\n * ```\n *\n * @class Action\n */\nexport class Action extends Subscription {\n constructor(scheduler: Scheduler, work: (this: SchedulerAction, state?: T) => void) {\n super();\n }\n /**\n * Schedules this action on its parent {@link SchedulerLike} for execution. May be passed\n * some context object, `state`. May happen at some point in the future,\n * according to the `delay` parameter, if specified.\n * @param {T} [state] Some contextual data that the `work` function uses when\n * called by the Scheduler.\n * @param {number} [delay] Time to wait before executing the work, where the\n * time unit is implicit and defined by the Scheduler.\n * @return {void}\n */\n public schedule(state?: T, delay: number = 0): Subscription {\n return this;\n }\n}\n", "import type { TimerHandle } from './timerHandle';\ntype SetIntervalFunction = (handler: () => void, timeout?: number, ...args: any[]) => TimerHandle;\ntype ClearIntervalFunction = (handle: TimerHandle) => void;\n\ninterface IntervalProvider {\n setInterval: SetIntervalFunction;\n clearInterval: ClearIntervalFunction;\n delegate:\n | {\n setInterval: SetIntervalFunction;\n clearInterval: ClearIntervalFunction;\n }\n | undefined;\n}\n\nexport const intervalProvider: IntervalProvider = {\n // When accessing the delegate, use the variable rather than `this` so that\n // the functions can be called without being bound to the provider.\n setInterval(handler: () => void, timeout?: number, ...args) {\n const { delegate } = intervalProvider;\n if (delegate?.setInterval) {\n return delegate.setInterval(handler, timeout, ...args);\n }\n return setInterval(handler, timeout, ...args);\n },\n clearInterval(handle) {\n const { delegate } = intervalProvider;\n return (delegate?.clearInterval || clearInterval)(handle as any);\n },\n delegate: undefined,\n};\n", "import { Action } from './Action';\nimport { SchedulerAction } from '../types';\nimport { Subscription } from '../Subscription';\nimport { AsyncScheduler } from './AsyncScheduler';\nimport { intervalProvider } from './intervalProvider';\nimport { arrRemove } from '../util/arrRemove';\nimport { TimerHandle } from './timerHandle';\n\nexport class AsyncAction extends Action {\n public id: TimerHandle | undefined;\n public state?: T;\n // @ts-ignore: Property has no initializer and is not definitely assigned\n public delay: number;\n protected pending: boolean = false;\n\n constructor(protected scheduler: AsyncScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n public schedule(state?: T, delay: number = 0): Subscription {\n if (this.closed) {\n return this;\n }\n\n // Always replace the current state with the new state.\n this.state = state;\n\n const id = this.id;\n const scheduler = this.scheduler;\n\n //\n // Important implementation note:\n //\n // Actions only execute once by default, unless rescheduled from within the\n // scheduled callback. This allows us to implement single and repeat\n // actions via the same code path, without adding API surface area, as well\n // as mimic traditional recursion but across asynchronous boundaries.\n //\n // However, JS runtimes and timers distinguish between intervals achieved by\n // serial `setTimeout` calls vs. a single `setInterval` call. An interval of\n // serial `setTimeout` calls can be individually delayed, which delays\n // scheduling the next `setTimeout`, and so on. `setInterval` attempts to\n // guarantee the interval callback will be invoked more precisely to the\n // interval period, regardless of load.\n //\n // Therefore, we use `setInterval` to schedule single and repeat actions.\n // If the action reschedules itself with the same delay, the interval is not\n // canceled. If the action doesn't reschedule, or reschedules with a\n // different delay, the interval will be canceled after scheduled callback\n // execution.\n //\n if (id != null) {\n this.id = this.recycleAsyncId(scheduler, id, delay);\n }\n\n // Set the pending flag indicating that this action has been scheduled, or\n // has recursively rescheduled itself.\n this.pending = true;\n\n this.delay = delay;\n // If this action has already an async Id, don't request a new one.\n this.id = this.id ?? this.requestAsyncId(scheduler, this.id, delay);\n\n return this;\n }\n\n protected requestAsyncId(scheduler: AsyncScheduler, _id?: TimerHandle, delay: number = 0): TimerHandle {\n return intervalProvider.setInterval(scheduler.flush.bind(scheduler, this), delay);\n }\n\n protected recycleAsyncId(_scheduler: AsyncScheduler, id?: TimerHandle, delay: number | null = 0): TimerHandle | undefined {\n // If this action is rescheduled with the same delay time, don't clear the interval id.\n if (delay != null && this.delay === delay && this.pending === false) {\n return id;\n }\n // Otherwise, if the action's delay time is different from the current delay,\n // or the action has been rescheduled before it's executed, clear the interval id\n if (id != null) {\n intervalProvider.clearInterval(id);\n }\n\n return undefined;\n }\n\n /**\n * Immediately executes this action and the `work` it contains.\n * @return {any}\n */\n public execute(state: T, delay: number): any {\n if (this.closed) {\n return new Error('executing a cancelled action');\n }\n\n this.pending = false;\n const error = this._execute(state, delay);\n if (error) {\n return error;\n } else if (this.pending === false && this.id != null) {\n // Dequeue if the action didn't reschedule itself. Don't call\n // unsubscribe(), because the action could reschedule later.\n // For example:\n // ```\n // scheduler.schedule(function doWork(counter) {\n // /* ... I'm a busy worker bee ... */\n // var originalAction = this;\n // /* wait 100ms before rescheduling the action */\n // setTimeout(function () {\n // originalAction.schedule(counter + 1);\n // }, 100);\n // }, 1000);\n // ```\n this.id = this.recycleAsyncId(this.scheduler, this.id, null);\n }\n }\n\n protected _execute(state: T, _delay: number): any {\n let errored: boolean = false;\n let errorValue: any;\n try {\n this.work(state);\n } catch (e) {\n errored = true;\n // HACK: Since code elsewhere is relying on the \"truthiness\" of the\n // return here, we can't have it return \"\" or 0 or false.\n // TODO: Clean this up when we refactor schedulers mid-version-8 or so.\n errorValue = e ? e : new Error('Scheduled action threw falsy error');\n }\n if (errored) {\n this.unsubscribe();\n return errorValue;\n }\n }\n\n unsubscribe() {\n if (!this.closed) {\n const { id, scheduler } = this;\n const { actions } = scheduler;\n\n this.work = this.state = this.scheduler = null!;\n this.pending = false;\n\n arrRemove(actions, this);\n if (id != null) {\n this.id = this.recycleAsyncId(scheduler, id, null);\n }\n\n this.delay = null!;\n super.unsubscribe();\n }\n }\n}\n", "import { Action } from './scheduler/Action';\nimport { Subscription } from './Subscription';\nimport { SchedulerLike, SchedulerAction } from './types';\nimport { dateTimestampProvider } from './scheduler/dateTimestampProvider';\n\n/**\n * An execution context and a data structure to order tasks and schedule their\n * execution. Provides a notion of (potentially virtual) time, through the\n * `now()` getter method.\n *\n * Each unit of work in a Scheduler is called an `Action`.\n *\n * ```ts\n * class Scheduler {\n * now(): number;\n * schedule(work, delay?, state?): Subscription;\n * }\n * ```\n *\n * @class Scheduler\n * @deprecated Scheduler is an internal implementation detail of RxJS, and\n * should not be used directly. Rather, create your own class and implement\n * {@link SchedulerLike}. Will be made internal in v8.\n */\nexport class Scheduler implements SchedulerLike {\n public static now: () => number = dateTimestampProvider.now;\n\n constructor(private schedulerActionCtor: typeof Action, now: () => number = Scheduler.now) {\n this.now = now;\n }\n\n /**\n * A getter method that returns a number representing the current time\n * (at the time this function was called) according to the scheduler's own\n * internal clock.\n * @return {number} A number that represents the current time. May or may not\n * have a relation to wall-clock time. May or may not refer to a time unit\n * (e.g. milliseconds).\n */\n public now: () => number;\n\n /**\n * Schedules a function, `work`, for execution. May happen at some point in\n * the future, according to the `delay` parameter, if specified. May be passed\n * some context object, `state`, which will be passed to the `work` function.\n *\n * The given arguments will be processed an stored as an Action object in a\n * queue of actions.\n *\n * @param {function(state: ?T): ?Subscription} work A function representing a\n * task, or some unit of work to be executed by the Scheduler.\n * @param {number} [delay] Time to wait before executing the work, where the\n * time unit is implicit and defined by the Scheduler itself.\n * @param {T} [state] Some contextual data that the `work` function uses when\n * called by the Scheduler.\n * @return {Subscription} A subscription in order to be able to unsubscribe\n * the scheduled work.\n */\n public schedule(work: (this: SchedulerAction, state?: T) => void, delay: number = 0, state?: T): Subscription {\n return new this.schedulerActionCtor(this, work).schedule(state, delay);\n }\n}\n", "import { Scheduler } from '../Scheduler';\nimport { Action } from './Action';\nimport { AsyncAction } from './AsyncAction';\nimport { TimerHandle } from './timerHandle';\n\nexport class AsyncScheduler extends Scheduler {\n public actions: Array> = [];\n /**\n * A flag to indicate whether the Scheduler is currently executing a batch of\n * queued actions.\n * @type {boolean}\n * @internal\n */\n public _active: boolean = false;\n /**\n * An internal ID used to track the latest asynchronous task such as those\n * coming from `setTimeout`, `setInterval`, `requestAnimationFrame`, and\n * others.\n * @type {any}\n * @internal\n */\n public _scheduled: TimerHandle | undefined;\n\n constructor(SchedulerAction: typeof Action, now: () => number = Scheduler.now) {\n super(SchedulerAction, now);\n }\n\n public flush(action: AsyncAction): void {\n const { actions } = this;\n\n if (this._active) {\n actions.push(action);\n return;\n }\n\n let error: any;\n this._active = true;\n\n do {\n if ((error = action.execute(action.state, action.delay))) {\n break;\n }\n } while ((action = actions.shift()!)); // exhaust the scheduler queue\n\n this._active = false;\n\n if (error) {\n while ((action = actions.shift()!)) {\n action.unsubscribe();\n }\n throw error;\n }\n }\n}\n", "import { AsyncAction } from './AsyncAction';\nimport { AsyncScheduler } from './AsyncScheduler';\n\n/**\n *\n * Async Scheduler\n *\n * Schedule task as if you used setTimeout(task, duration)\n *\n * `async` scheduler schedules tasks asynchronously, by putting them on the JavaScript\n * event loop queue. It is best used to delay tasks in time or to schedule tasks repeating\n * in intervals.\n *\n * If you just want to \"defer\" task, that is to perform it right after currently\n * executing synchronous code ends (commonly achieved by `setTimeout(deferredTask, 0)`),\n * better choice will be the {@link asapScheduler} scheduler.\n *\n * ## Examples\n * Use async scheduler to delay task\n * ```ts\n * import { asyncScheduler } from 'rxjs';\n *\n * const task = () => console.log('it works!');\n *\n * asyncScheduler.schedule(task, 2000);\n *\n * // After 2 seconds logs:\n * // \"it works!\"\n * ```\n *\n * Use async scheduler to repeat task in intervals\n * ```ts\n * import { asyncScheduler } from 'rxjs';\n *\n * function task(state) {\n * console.log(state);\n * this.schedule(state + 1, 1000); // `this` references currently executing Action,\n * // which we reschedule with new state and delay\n * }\n *\n * asyncScheduler.schedule(task, 3000, 0);\n *\n * // Logs:\n * // 0 after 3s\n * // 1 after 4s\n * // 2 after 5s\n * // 3 after 6s\n * ```\n */\n\nexport const asyncScheduler = new AsyncScheduler(AsyncAction);\n\n/**\n * @deprecated Renamed to {@link asyncScheduler}. Will be removed in v8.\n */\nexport const async = asyncScheduler;\n", "import { AsyncAction } from './AsyncAction';\nimport { Subscription } from '../Subscription';\nimport { QueueScheduler } from './QueueScheduler';\nimport { SchedulerAction } from '../types';\nimport { TimerHandle } from './timerHandle';\n\nexport class QueueAction extends AsyncAction {\n constructor(protected scheduler: QueueScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n public schedule(state?: T, delay: number = 0): Subscription {\n if (delay > 0) {\n return super.schedule(state, delay);\n }\n this.delay = delay;\n this.state = state;\n this.scheduler.flush(this);\n return this;\n }\n\n public execute(state: T, delay: number): any {\n return delay > 0 || this.closed ? super.execute(state, delay) : this._execute(state, delay);\n }\n\n protected requestAsyncId(scheduler: QueueScheduler, id?: TimerHandle, delay: number = 0): TimerHandle {\n // If delay exists and is greater than 0, or if the delay is null (the\n // action wasn't rescheduled) but was originally scheduled as an async\n // action, then recycle as an async action.\n\n if ((delay != null && delay > 0) || (delay == null && this.delay > 0)) {\n return super.requestAsyncId(scheduler, id, delay);\n }\n\n // Otherwise flush the scheduler starting with this action.\n scheduler.flush(this);\n\n // HACK: In the past, this was returning `void`. However, `void` isn't a valid\n // `TimerHandle`, and generally the return value here isn't really used. So the\n // compromise is to return `0` which is both \"falsy\" and a valid `TimerHandle`,\n // as opposed to refactoring every other instanceo of `requestAsyncId`.\n return 0;\n }\n}\n", "import { AsyncScheduler } from './AsyncScheduler';\n\nexport class QueueScheduler extends AsyncScheduler {\n}\n", "import { QueueAction } from './QueueAction';\nimport { QueueScheduler } from './QueueScheduler';\n\n/**\n *\n * Queue Scheduler\n *\n * Put every next task on a queue, instead of executing it immediately\n *\n * `queue` scheduler, when used with delay, behaves the same as {@link asyncScheduler} scheduler.\n *\n * When used without delay, it schedules given task synchronously - executes it right when\n * it is scheduled. However when called recursively, that is when inside the scheduled task,\n * another task is scheduled with queue scheduler, instead of executing immediately as well,\n * that task will be put on a queue and wait for current one to finish.\n *\n * This means that when you execute task with `queue` scheduler, you are sure it will end\n * before any other task scheduled with that scheduler will start.\n *\n * ## Examples\n * Schedule recursively first, then do something\n * ```ts\n * import { queueScheduler } from 'rxjs';\n *\n * queueScheduler.schedule(() => {\n * queueScheduler.schedule(() => console.log('second')); // will not happen now, but will be put on a queue\n *\n * console.log('first');\n * });\n *\n * // Logs:\n * // \"first\"\n * // \"second\"\n * ```\n *\n * Reschedule itself recursively\n * ```ts\n * import { queueScheduler } from 'rxjs';\n *\n * queueScheduler.schedule(function(state) {\n * if (state !== 0) {\n * console.log('before', state);\n * this.schedule(state - 1); // `this` references currently executing Action,\n * // which we reschedule with new state\n * console.log('after', state);\n * }\n * }, 0, 3);\n *\n * // In scheduler that runs recursively, you would expect:\n * // \"before\", 3\n * // \"before\", 2\n * // \"before\", 1\n * // \"after\", 1\n * // \"after\", 2\n * // \"after\", 3\n *\n * // But with queue it logs:\n * // \"before\", 3\n * // \"after\", 3\n * // \"before\", 2\n * // \"after\", 2\n * // \"before\", 1\n * // \"after\", 1\n * ```\n */\n\nexport const queueScheduler = new QueueScheduler(QueueAction);\n\n/**\n * @deprecated Renamed to {@link queueScheduler}. Will be removed in v8.\n */\nexport const queue = queueScheduler;\n", "import { AsyncAction } from './AsyncAction';\nimport { AnimationFrameScheduler } from './AnimationFrameScheduler';\nimport { SchedulerAction } from '../types';\nimport { animationFrameProvider } from './animationFrameProvider';\nimport { TimerHandle } from './timerHandle';\n\nexport class AnimationFrameAction extends AsyncAction {\n constructor(protected scheduler: AnimationFrameScheduler, protected work: (this: SchedulerAction, state?: T) => void) {\n super(scheduler, work);\n }\n\n protected requestAsyncId(scheduler: AnimationFrameScheduler, id?: TimerHandle, delay: number = 0): TimerHandle {\n // If delay is greater than 0, request as an async action.\n if (delay !== null && delay > 0) {\n return super.requestAsyncId(scheduler, id, delay);\n }\n // Push the action to the end of the scheduler queue.\n scheduler.actions.push(this);\n // If an animation frame has already been requested, don't request another\n // one. If an animation frame hasn't been requested yet, request one. Return\n // the current animation frame request id.\n return scheduler._scheduled || (scheduler._scheduled = animationFrameProvider.requestAnimationFrame(() => scheduler.flush(undefined)));\n }\n\n protected recycleAsyncId(scheduler: AnimationFrameScheduler, id?: TimerHandle, delay: number = 0): TimerHandle | undefined {\n // If delay exists and is greater than 0, or if the delay is null (the\n // action wasn't rescheduled) but was originally scheduled as an async\n // action, then recycle as an async action.\n if (delay != null ? delay > 0 : this.delay > 0) {\n return super.recycleAsyncId(scheduler, id, delay);\n }\n // If the scheduler queue has no remaining actions with the same async id,\n // cancel the requested animation frame and set the scheduled flag to\n // undefined so the next AnimationFrameAction will request its own.\n const { actions } = scheduler;\n if (id != null && actions[actions.length - 1]?.id !== id) {\n animationFrameProvider.cancelAnimationFrame(id as number);\n scheduler._scheduled = undefined;\n }\n // Return undefined so the action knows to request a new async id if it's rescheduled.\n return undefined;\n }\n}\n", "import { AsyncAction } from './AsyncAction';\nimport { AsyncScheduler } from './AsyncScheduler';\n\nexport class AnimationFrameScheduler extends AsyncScheduler {\n public flush(action?: AsyncAction): void {\n this._active = true;\n // The async id that effects a call to flush is stored in _scheduled.\n // Before executing an action, it's necessary to check the action's async\n // id to determine whether it's supposed to be executed in the current\n // flush.\n // Previous implementations of this method used a count to determine this,\n // but that was unsound, as actions that are unsubscribed - i.e. cancelled -\n // are removed from the actions array and that can shift actions that are\n // scheduled to be executed in a subsequent flush into positions at which\n // they are executed within the current flush.\n const flushId = this._scheduled;\n this._scheduled = undefined;\n\n const { actions } = this;\n let error: any;\n action = action || actions.shift()!;\n\n do {\n if ((error = action.execute(action.state, action.delay))) {\n break;\n }\n } while ((action = actions[0]) && action.id === flushId && actions.shift());\n\n this._active = false;\n\n if (error) {\n while ((action = actions[0]) && action.id === flushId && actions.shift()) {\n action.unsubscribe();\n }\n throw error;\n }\n }\n}\n", "import { AnimationFrameAction } from './AnimationFrameAction';\nimport { AnimationFrameScheduler } from './AnimationFrameScheduler';\n\n/**\n *\n * Animation Frame Scheduler\n *\n * Perform task when `window.requestAnimationFrame` would fire\n *\n * When `animationFrame` scheduler is used with delay, it will fall back to {@link asyncScheduler} scheduler\n * behaviour.\n *\n * Without delay, `animationFrame` scheduler can be used to create smooth browser animations.\n * It makes sure scheduled task will happen just before next browser content repaint,\n * thus performing animations as efficiently as possible.\n *\n * ## Example\n * Schedule div height animation\n * ```ts\n * // html:
\n * import { animationFrameScheduler } from 'rxjs';\n *\n * const div = document.querySelector('div');\n *\n * animationFrameScheduler.schedule(function(height) {\n * div.style.height = height + \"px\";\n *\n * this.schedule(height + 1); // `this` references currently executing Action,\n * // which we reschedule with new state\n * }, 0, 0);\n *\n * // You will see a div element growing in height\n * ```\n */\n\nexport const animationFrameScheduler = new AnimationFrameScheduler(AnimationFrameAction);\n\n/**\n * @deprecated Renamed to {@link animationFrameScheduler}. Will be removed in v8.\n */\nexport const animationFrame = animationFrameScheduler;\n", "import { Observable } from '../Observable';\nimport { SchedulerLike } from '../types';\n\n/**\n * A simple Observable that emits no items to the Observer and immediately\n * emits a complete notification.\n *\n * Just emits 'complete', and nothing else.\n *\n * ![](empty.png)\n *\n * A simple Observable that only emits the complete notification. It can be used\n * for composing with other Observables, such as in a {@link mergeMap}.\n *\n * ## Examples\n *\n * Log complete notification\n *\n * ```ts\n * import { EMPTY } from 'rxjs';\n *\n * EMPTY.subscribe({\n * next: () => console.log('Next'),\n * complete: () => console.log('Complete!')\n * });\n *\n * // Outputs\n * // Complete!\n * ```\n *\n * Emit the number 7, then complete\n *\n * ```ts\n * import { EMPTY, startWith } from 'rxjs';\n *\n * const result = EMPTY.pipe(startWith(7));\n * result.subscribe(x => console.log(x));\n *\n * // Outputs\n * // 7\n * ```\n *\n * Map and flatten only odd numbers to the sequence `'a'`, `'b'`, `'c'`\n *\n * ```ts\n * import { interval, mergeMap, of, EMPTY } from 'rxjs';\n *\n * const interval$ = interval(1000);\n * const result = interval$.pipe(\n * mergeMap(x => x % 2 === 1 ? of('a', 'b', 'c') : EMPTY),\n * );\n * result.subscribe(x => console.log(x));\n *\n * // Results in the following to the console:\n * // x is equal to the count on the interval, e.g. (0, 1, 2, 3, ...)\n * // x will occur every 1000ms\n * // if x % 2 is equal to 1, print a, b, c (each on its own)\n * // if x % 2 is not equal to 1, nothing will be output\n * ```\n *\n * @see {@link Observable}\n * @see {@link NEVER}\n * @see {@link of}\n * @see {@link throwError}\n */\nexport const EMPTY = new Observable((subscriber) => subscriber.complete());\n\n/**\n * @param scheduler A {@link SchedulerLike} to use for scheduling\n * the emission of the complete notification.\n * @deprecated Replaced with the {@link EMPTY} constant or {@link scheduled} (e.g. `scheduled([], scheduler)`). Will be removed in v8.\n */\nexport function empty(scheduler?: SchedulerLike) {\n return scheduler ? emptyScheduled(scheduler) : EMPTY;\n}\n\nfunction emptyScheduled(scheduler: SchedulerLike) {\n return new Observable((subscriber) => scheduler.schedule(() => subscriber.complete()));\n}\n", "import { SchedulerLike } from '../types';\nimport { isFunction } from './isFunction';\n\nexport function isScheduler(value: any): value is SchedulerLike {\n return value && isFunction(value.schedule);\n}\n", "import { SchedulerLike } from '../types';\nimport { isFunction } from './isFunction';\nimport { isScheduler } from './isScheduler';\n\nfunction last(arr: T[]): T | undefined {\n return arr[arr.length - 1];\n}\n\nexport function popResultSelector(args: any[]): ((...args: unknown[]) => unknown) | undefined {\n return isFunction(last(args)) ? args.pop() : undefined;\n}\n\nexport function popScheduler(args: any[]): SchedulerLike | undefined {\n return isScheduler(last(args)) ? args.pop() : undefined;\n}\n\nexport function popNumber(args: any[], defaultValue: number): number {\n return typeof last(args) === 'number' ? args.pop()! : defaultValue;\n}\n", "export const isArrayLike = ((x: any): x is ArrayLike => x && typeof x.length === 'number' && typeof x !== 'function');", "import { isFunction } from \"./isFunction\";\n\n/**\n * Tests to see if the object is \"thennable\".\n * @param value the object to test\n */\nexport function isPromise(value: any): value is PromiseLike {\n return isFunction(value?.then);\n}\n", "import { InteropObservable } from '../types';\nimport { observable as Symbol_observable } from '../symbol/observable';\nimport { isFunction } from './isFunction';\n\n/** Identifies an input as being Observable (but not necessary an Rx Observable) */\nexport function isInteropObservable(input: any): input is InteropObservable {\n return isFunction(input[Symbol_observable]);\n}\n", "import { isFunction } from './isFunction';\n\nexport function isAsyncIterable(obj: any): obj is AsyncIterable {\n return Symbol.asyncIterator && isFunction(obj?.[Symbol.asyncIterator]);\n}\n", "/**\n * Creates the TypeError to throw if an invalid object is passed to `from` or `scheduled`.\n * @param input The object that was passed.\n */\nexport function createInvalidObservableTypeError(input: any) {\n // TODO: We should create error codes that can be looked up, so this can be less verbose.\n return new TypeError(\n `You provided ${\n input !== null && typeof input === 'object' ? 'an invalid object' : `'${input}'`\n } where a stream was expected. You can provide an Observable, Promise, ReadableStream, Array, AsyncIterable, or Iterable.`\n );\n}\n", "export function getSymbolIterator(): symbol {\n if (typeof Symbol !== 'function' || !Symbol.iterator) {\n return '@@iterator' as any;\n }\n\n return Symbol.iterator;\n}\n\nexport const iterator = getSymbolIterator();\n", "import { iterator as Symbol_iterator } from '../symbol/iterator';\nimport { isFunction } from './isFunction';\n\n/** Identifies an input as being an Iterable */\nexport function isIterable(input: any): input is Iterable {\n return isFunction(input?.[Symbol_iterator]);\n}\n", "import { ReadableStreamLike } from '../types';\nimport { isFunction } from './isFunction';\n\nexport async function* readableStreamLikeToAsyncGenerator(readableStream: ReadableStreamLike): AsyncGenerator {\n const reader = readableStream.getReader();\n try {\n while (true) {\n const { value, done } = await reader.read();\n if (done) {\n return;\n }\n yield value!;\n }\n } finally {\n reader.releaseLock();\n }\n}\n\nexport function isReadableStreamLike(obj: any): obj is ReadableStreamLike {\n // We don't want to use instanceof checks because they would return\n // false for instances from another Realm, like an