Add nucleotide-count

Author: koladilip

nucleotide-count/README.md

@@ -0,0 +1,73 @@
+# Nucleotide Count
+
+Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+
+The genetic language of every living thing on the planet is DNA.
+DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+Here is an analogy:
+- twigs are to birds nests as
+- nucleotides are to DNA as
+- legos are to lego houses as
+- words are to sentences as...
+
+
+## Getting Started
+
+Please refer to the [installation](https://exercism.io/tracks/haskell/installation)
+and [learning](https://exercism.io/tracks/haskell/learning) help pages.
+
+## Running the tests
+
+To run the test suite, execute the following command:
+
+```bash
+stack test
+```
+
+#### If you get an error message like this...
+
+```
+No .cabal file found in directory
+```
+
+You are probably running an old stack version and need
+to upgrade it.
+
+#### Otherwise, if you get an error message like this...
+
+```
+No compiler found, expected minor version match with...
+Try running "stack setup" to install the correct GHC...
+```
+
+Just do as it says and it will download and install
+the correct compiler version:
+
+```bash
+stack setup
+```
+
+## Running *GHCi*
+
+If you want to play with your solution in GHCi, just run the command:
+
+```bash
+stack ghci
+```
+
+## Feedback, Issues, Pull Requests
+
+The [exercism/haskell](https://github.com/exercism/haskell) repository on
+GitHub is the home for all of the Haskell exercises.
+
+If you have feedback about an exercise, or want to help implementing a new
+one, head over there and create an issue.  We'll do our best to help you!
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.

nucleotide-count/nucleotide-count.cabal

@@ -0,0 +1,38 @@
+cabal-version: 1.12
+
+-- This file has been generated from package.yaml by hpack version 0.33.0.
+--
+-- see: https://github.com/sol/hpack
+--
+-- hash: c85b93dcc5a9010c6db8d786cc1b90e30eb1c4a39356b7989c4d331b1f6af460
+
+name:           nucleotide-count
+version:        1.3.0.8
+build-type:     Simple
+
+library
+  exposed-modules:
+      DNA
+  other-modules:
+      Paths_nucleotide_count
+  hs-source-dirs:
+      src
+  ghc-options: -Wall
+  build-depends:
+      base
+    , containers
+  default-language: Haskell2010
+
+test-suite test
+  type: exitcode-stdio-1.0
+  main-is: Tests.hs
+  other-modules:
+      Paths_nucleotide_count
+  hs-source-dirs:
+      test
+  build-depends:
+      base
+    , containers
+    , hspec
+    , nucleotide-count
+  default-language: Haskell2010

nucleotide-count/package.yaml

@@ -0,0 +1,22 @@
+name: nucleotide-count
+version: 1.3.0.8
+
+dependencies:
+  - base
+  - containers
+
+library:
+  exposed-modules: DNA
+  source-dirs: src
+  ghc-options: -Wall
+  # dependencies:
+  # - foo       # List here the packages you
+  # - bar       # want to use in your solution.
+
+tests:
+  test:
+    main: Tests.hs
+    source-dirs: test
+    dependencies:
+      - nucleotide-count
+      - hspec

nucleotide-count/src/DNA.hs

@@ -0,0 +1,20 @@
+module DNA (nucleotideCounts, Nucleotide(..)) where
+
+import Data.Map (Map)
+import qualified Data.Map as Map
+
+data Nucleotide = A | C | G | T deriving (Eq, Ord, Show)
+
+dnaMap :: Map Nucleotide Int
+dnaMap = foldl (\acc c -> Map.insert c 0 acc) Map.empty [A, C, G, T]
+
+nucleotideCounts :: String -> Either String (Map Nucleotide Int)
+nucleotideCounts xs = foldl addToMap (Right dnaMap) xs
+    where 
+        addToMap (Left a) _  = Left a
+        addToMap (Right a) c
+            | c == 'A' = Right (Map.insertWith (+) A 1 a)
+            | c == 'C' = Right (Map.insertWith (+) C 1 a)
+            | c == 'G' = Right (Map.insertWith (+) G 1 a)
+            | c == 'T' = Right (Map.insertWith (+) T 1 a)
+            | otherwise = Left xs

nucleotide-count/stack.yaml

@@ -0,0 +1 @@
+resolver: lts-15.8

nucleotide-count/stack.yaml.lock

@@ -0,0 +1,12 @@
+# This file was autogenerated by Stack.
+# You should not edit this file by hand.
+# For more information, please see the documentation at:
+#   https://docs.haskellstack.org/en/stable/lock_files
+
+packages: []
+snapshots:
+- completed:
+    size: 492015
+    url: https://raw.githubusercontent.com/commercialhaskell/stackage-snapshots/master/lts/15/8.yaml
+    sha256: 926bc3d70249dd0ba05277ff00943c0addb35b627cb641752669e7cf771310d0
+  original: lts-15.8

nucleotide-count/test/Tests.hs

@@ -0,0 +1,49 @@
+{-# OPTIONS_GHC -fno-warn-type-defaults #-}
+{-# language LambdaCase #-}
+
+import Data.Either       (isLeft)
+import Data.Map          (findWithDefault)
+import Test.Hspec        (Spec, describe, it, shouldSatisfy)
+import Test.Hspec.Runner (configFastFail, defaultConfig, hspecWith)
+
+import DNA (nucleotideCounts, Nucleotide(..))
+
+main :: IO ()
+main = hspecWith defaultConfig {configFastFail = True} specs
+
+specs :: Spec
+specs = do
+
+          let x `matchesMap` y = shouldSatisfy x $ \case
+                Right count -> and [ findWithDefault 0 n count == c | (n,c) <- y ]
+                Left _ -> False
+
+          describe "nucleotideCounts" $ do
+
+            it "empty dna strand has no nucleotides" $
+              nucleotideCounts "" `matchesMap` [ (A, 0)
+                                               , (C, 0)
+                                               , (G, 0)
+                                               , (T, 0) ]
+
+            it "can count one nucleotide in single-character input" $
+              nucleotideCounts "G" `matchesMap` [ (A, 0)
+                                                , (C, 0)
+                                                , (G, 1)
+                                                , (T, 0) ]
+
+            it "repetitive-sequence-has-only-guanosine" $
+              nucleotideCounts "GGGGGGGG" `matchesMap` [ (A, 0)
+                                                       , (C, 0)
+                                                       , (G, 8)
+                                                       , (T, 0) ]
+
+            it "counts all nucleotides" $
+              nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+              `matchesMap` [ (A, 20)
+                           , (C, 12)
+                           , (G, 17)
+                           , (T, 21) ]
+
+            it "validates strand" $
+              nucleotideCounts "AGXXACT" `shouldSatisfy` isLeft