Skip to content

annasATCG/COMPSRA

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

27 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

COMPSRA

COMPSRA: a COMprehensive Platform for Small RNA-seq data AnalySis (v1.0)

0 Release Note

COMPSRA V1.0.3 (2020-11-11)

  • Fix the bug for downloading mouse reference genome

    e.g. java -jar COMPSRA.jar -tk -dr -ck star_mm10

COMPSRA V1.0.2 (2020-07-03)

  • Add downloading function for rno5 and rno6

    e.g. java -jar COMPSRA.jar -tk -dr -ck miRNA_rno6

    e.g. java -jar COMPSRA.jar -tk -dr -ck star_rno6

COMPSRA V1.0.1 (2020-06-28)

  • Add prebuilt miRNA database for Rattus norvegicus.
  • Support both GCA_000001895.4/rno6 and GCA_000001895.3/rno5.

1 Introduction

COMPSRA was composed of five functional modules: Quality Control, Alignment, Annotation, Microbe and Function. They are integrated into a pipeline and each module can also process independently.

  • Quality Control To deal with fastq files and filter out the adapter sequences and reads with low quality. FASTQ files from the small RNA sequencing of biological samples are the default input. First, the adapter portions of a read are trimmed along with any randomized bases at ligation junctions that are produced by some small RNA-seq kits (e.g., NEXTflexTM Small RNA-Seq kit). The read quality of the remaining sequence is evaluated using its corresponding Phred score. Poor quality reads are removed according to quality control parameters set in the command line (-rh 20 –rt 20 –rr 20). Users can specify qualified reads of specific length intervals for input into subse-quent modules.

  • Alignment To align the clean reads to the reference genome. COMPSRA uses STAR as its default RNA sequence aligner with default parameters which are customizable on the command line. Qualified reads from the QC module output are first mapped to the human genome hg19/hg38, and then aligned reads are quantified and annotated in the Annotation Module. Reads that could not be mapped to the human genome are saved into a FASTA file for input into the Microbe Module.

  • Annotation To annotate different kinds of circulating RNAs based on the alignment result. COMPSRA currently uses several different small RNA databases for annotating human genome mapped reads and provides all the possible annotations: miRBase for miRNA; piRNABank, piRBase and piRNACluster for piRNA; gtRNAdb for tRNA; GENCODE release 27 for snRNA and snoRNA; circBase for circular RNA. To conform the different reference human genome versions in these databases, we use an automatic LiftOver created by the UCSC Genome Browser Group. All the databases used are already pre-built, enabling speedy annotation.

  • Microbe To predict the possible species of microbes existed in the samples. The qualified reads that could not be mapped to the human genome in the Alignment Module are aligned to the nucleotide (nt) database from UCSC using BLAST. The four major microbial taxons archaea, bacteria, fungi and viruses are supported.

  • Function To perform differential expression analysis and other functional studies to be extended. The read count of each RNA molecule that is identified in the Annotation Module is outputted as a tab-delimited text file according to RNA type. With more than one sample FASTQ file inputs, the out-put are further aggregated into a data matrix of RNA molecules as rows and samples as columns showing the read counts of an RNA molecule across different samples. The user can mark each sample FASTQ file column as either a case or a control in the command line, and perform a case versus control differential expression analysis for each RNA molecule using the Mann-Whitney rank sum test (Wilcoxon Rank Sum Test) as the default statistical test.

2 Installation

2.1 JAVA Virtual Machine

COMPSRA was achieved by Java language, so Java Runtime Environment (JRE) version 8 (or up) is required. The JRE can be downloaded in ORACLE website (http://www.oracle.com/technetwork/java/javase/downloads/index.html).

2.2 COMPSRA

You can download COMPSRA from https://regepi.bwh.harvard.edu/circurna/ COMPSRA_v1.0.zip or the GitHub website https://github.com/cougarlj/COMPSRA.

2.3 STAR

COMPSRA will take STAR as the default aligner. STAR can be downloaded from Google Code (https://code.google.com/archive/p/rna-star/downloads). You can install STAR by yourself in the COMPSRA plug directory or by COMPSRA itself.

2.4 Build-in Installation System

When you installed the JAVA Virtual Machine and COMPSRA successfully, you could use the COMPSRA build-in installation system which was collected into COMPSRA ToolKit (-tk).

Download STAR You can download STAR directly from the command: java -jar COMPSRA.jar -tk -dr -ck star

Download Annotation Database COMPSRA supports the annotation of miRNA, piRNA, tRNA, snoRNA, snRNA and circRNA with both hg38 and hg19 version. The database can be represented as the combination of RNA name and genome version, connecting by “_”, such as miRNA_hg38, piRNA_hg38 and snoRNA_hg19. So you can download these database by the command: java -jar COMPSRA.jar -tk -dr -ck miRNA_hg38,piRNA_hg38,tRNA_hg38,...

Download human genome for STAR Before running STAR for alignment, you should download the reference genome and build the index. You can download the human reference genome hg38 by the command: java -jar COMPSRA.jar -tk -dr -ck star_hg38. COMPSRA can build the index when it runs for the first time. If failed, please enter the STAR installation directory and set it executive through the command chmod.

3 Examples

(NOte: We demonstrate COMPSRA in the ~/COMPSRA directory in Linux OS.)

~$ mkdir COMPSRA

~$ mkdir COMPSRA

3.1 Preparation

3.1.1 Download COMPSRA

~/COMPSRA$ wget https://regepi.bwh.harvard.edu/circurna/COMPSRA_V1.0.zip

~/COMPSRA$ unzip COMPSRA_V1.0.zip

After uncompressing the zip file, you can find the following materials:

-COMPSRA.jar : This is the compiled jar package of COMPSRA.

-COMPSRA_tutorial_v1.0.pdf : The tutorial of COMPSRA v1.0.

-bundle_v1 : This directory contains all the resources that COMPSRA may used, such as databases, reference genome, plugs.

-example : This directory contains examples for demonstration.

3.1.2 Download Resources

Download miRNA prebuilt databases:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck miRNA_hg38

Download piRNA prebuilt databases:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck piRNA_hg38

Download tRNA prebuilt databases:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck tRNA_hg38

Download snoRNA prebuilt databases:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck snoRNA_hg38

Download snRNA prebuilt databases:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck snRNA_hg38

Download circRNA prebuilt databases:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck circRNA_hg38

Download all prebuilt databases:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck miRNA_hg38,piRNA_hg38,tRNA_hg38,snoRNA_hg38,snRNA_hg38,circRNA_hg38

3.1.3 Download and install STAR

Download STAR:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck star

Download human reference genome hg38:

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck star_hg38

3.2 Test Examples

3.2.1 Run COMPSRA module by module

QC Module:

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -in ./example/sample01.fastq -out ./example_out/

Alignment Module:

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -aln -mt star -mbi -in ./example_out/sample01/sample01_17to50_FitRead.fastq.gz -out ./example_out/sample01/sample01_17to50_FitRead

(Note: -mbi was only needed for the first time when you run COMPSRA and built the index files for STAR. This process will cost about 3 hours.)

Annotation Module:

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -ann -ac 1,2,3,4,5,6 -in ./example_out/sample01/sample01_17to50_FitRead_STAR_Aligned.out.bam -out ./example_out/sample01/sample01_17to50_FitRead_STAR_Aligned

(Note: The top three modules can run together in a pipeline.)

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -aln -mt star -ann -ac 1,2,3,4,5,6 -in ./example/sample01.fastq -out ./example_out/

(Note: When running multiple samples, you can write the input file names into a single file and use -inf instead of -in. Also, the three modules can be conducted in one command. )

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -aln -mt star -ann -ac 1,2,3,4,5,6 -inf ./example/sample.list -out ./example_out/

Function Module:

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -fun -fd -fdclass 1,2,3,4,5,6 -fdcase 1-6 -fdctrl 7-12 -fdnorm cpm -fdtest mwu -fdann -pro COMPSRA_DEG -inf ./example/sample.list -out ./example_out/

(Note: If you only want to merge the count files, you can use -fm -fms.)

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -fun -fm -fms 1-12 -fdclass 1,2,3,4,5,6 -fdann -pro COMPSRA_MERGE -inf ./example/sample.list -out ./example_out/

3.2.2 Run COMPSRA in a pipeline

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -aln -mt star -ann -ac 1,2,3,4,5,6 -fun -fd -fdclass 1,2,3,4,5,6 -fdcase 1-6 -fdctrl 7-12 -fdnorm cpm -fdtest mwu -fdann -pro ALL_DEG -inf ./example/sample.list -out ./example_out/

(Note: To merge count files, you can still run COMPSRA in a pipeline.)

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -aln -mt star -ann -ac 1,2,3,4,5,6 -fun -fm -fms 1-12 -fdclass 1,2,3,4,5,6 -fdann -pro ALL_MERGE -inf ./example/sample.list -out ./example_out/

3.2.3 Microbe Module (Optional)

(Note: To run Microbe Module, you may need to download more resources. Here, we take archaea as an example.)

Step 1: Download and install BLAST.

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck blast

Step 2: Download taxonomy information.

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck blast_taxonomy

Step 3: Download microbial prebuilt database. In COMPSRA, we have prebuilt four microbial databases: blast_archaea, blast_bacteria, blast_fungi, blast_viruses.

~/COMPSRA$ java -jar COMPSRA.jar -tk -dr -ck blast_archaea

Step 4: Run Microbe Module in COMPSRA with -mic.

~/COMPSRA$ java -jar COMPSRA.jar -mic -mtool Blast -mdb archaea -in ./example_out/sample01/sample01_17to50_FitRead_STAR_Aligned_UnMapped.bam -out ./example_out/

(Note: You can still add the Microbe Module into the whole pipeline.)

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -aln -mt star -ann -ac 1,2,3,4,5,6 -mic -mtool Blast -mdb archaea -in ./example/sample01.fastq -out ./example_out/

(Note: For multiple samples, take a file list as input. )

~/COMPSRA$ java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -aln -mt star -ann -ac 1,2,3,4,5,6 -mic -mtool Blast -mdb archaea -inf ./example/sample.list -out ./example_out/

4 Options

4.1 General Settings

4.1.1 -h/-help

To display the help information of COMPSRA.

4.1.2 -t/-threads n

To set the maximum of threads that COMPSRA will use when running. The default setting is 1.

4.1.3 -pro/-project_name ProjectName

To set the project name. The default setting is COMPSRA.

4.1.4 -ref/-ref_genome hg19/hg38

To set the reference genome that is used for alignment. Currently, COMPSRA supports hg19 (http://hgdownload.soe.ucsc.edu/goldenPath/hg19/bigZips/chromFa.tar.gz) and hg38 (http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz) genome version.

4.1.5 -in/-input file1;file2;...;fileN

To set the input file. The valid format is fastq file or SAM file.

4.1.6 -inf/-in_file file.list

To set the input files through a file list. In the file list, each line should only contain one file without any delimiter.

4.1.7 -out/-output /my/output/path/

To set the output files. If no setting, COMPSRA will create an output directory in the user working path and take the input prefix in default.

4.2 Quality Control

4.2.1 -qc/-quality_control

To open or close the quality control module.

4.2.2 -ra/-rm_adapter seq

To remove the adapter sequences at the 3’ (3-prime) end. The commonly used adapter sequences from different kits are listed below:

  • TruSeq Small RNA (Illumina) TGGAATTCTCGGGTGCCAAGG
  • Small RNA Kits V1 (Illumina) TCGTATGCCGTCTTCTGCTTGT
  • Small RNA Kits V1.5 (Illumina) ATCTCGTATGCCGTCTTCTGCTTG
  • NEXTflex Small RNA Sequencing Kit v3 for Illumina Platforms (Bioo Scientific) TGGAATTCTCGGGTGCCAAGG
  • LEXOGEN Small RNA-Seq Library Prep Kit (Illumina) TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC

4.2.3 -rb/-rm_bias n

To remove n random bases in both 5’ (5-prime) and 3’ (3-prime) ends after removing the adapter sequence.

4.2.4 -rh/-rm_low_quality_head score

To remove the low quality bases with the score less than score from 5’ (5-prime) end.

4.2.5 -rt/-rm_low_quality_tail score

To remove the low quality bases with the score less than score from 3’ (3-prime) end.

4.2.6 -rr/-rm_low_quality_read score

To remove the low quality reads with the average score less than score.

4.2.7 -rhh/-rm_head_hard n

To remove n bases from the 5’ (5-prime) end.

4.2.8 -rth/-rm_tail_hard n

To remove n bases from the 3’ (3-prime) end.

4.2.9 -rlh/-rm_read_hard D1,D2,...,Dn

To divide the reads into several groups according to [0,D1),[D1,D2),...,[Dn-1,Dn].

4.3 Alignment

4.3.1 -aln/-alignment

To open or close the alignment module.

4.3.2 -mt/-mapping_tool star/bowtie/bowtie2

To set the aligner used in COMPSRA. The default aligner is star

4.3.3 -mp/-mapping_param

To set parameters of the aligner. The default settings for star/bowtie/bowtie2 are listed below:

• star

--runThreadN 4 --runMode alignReads
--outSAMtype BAM Unsorted
--outSAMattributes Standard
--readFilesCommand zcat
--outSAMunmapped Within
--outReadsUnmapped None
--alignEndsType Local --alignIntronMax 1
--alignIntronMin 2
--outFilterMismatchNmax 1
--outFilterMultimapScoreRange 1
--outFilterScoreMinOverLread 0.66
--outFilterMatchNminOverLread 0.66
--outFilterMismatchNoverLmax 0.05
--outFilterMatchNmin 16
--outFilterMultimapNmax 1000000

• bowtie

• bowtie2

4.3.4 -midx/-mapping_index R1,R2,...,Rn

To set the read group that will be used for alignment. The default value is ”last” , which means the group with the longest reads. Otherwise, the number Rn denotes the index of region when setting the parameter -rlh/-rm_read_hard D1,D2,...,Dn.

4.3.5 -mref/-mapping_reference hg19/hg38

To set the reference genome in alignment. The default value is the same as the parameter -ref/-ref_genome hg19/hg38.

4.4 Annotation

4.4.1 -ann/-annotation

To open/close the annotation module.

4.4.2 -ac/-ann_class A1,A2,...,An

To set the small RNA categories that will be annotated. The index of small RNA is listed:

  • 1 miRNA
  • 2 piRNA
  • 3 tRNA
  • 4 snoRNA
  • 5 snRNA
  • 6 circRNA

4.4.3 -aol/-ann_overlap n

To set the overlap rate between reads and gene regions. The default value is 1.0.

4.4.4 -aic/-ann_inCluster

To show whether or not piRNAs are in the piRNA clusters when annotating piRNAs. The default value is false.

4.4.5 -atd/-ann_threshold n

To set the threshold of read counts of small RNAs. If set, only the small RNAs with the read count more than n are displayed. The default value is 1.

4.4.6 -armsm/-ann_remove_sam

If added, the original sam file from alignment module will be removed.

4.5 Microbe

4.5.1 -mic/-microbe

To open/close the microbe module.

4.5.2 -mtool/-mic_tool blast

To set the tool that will be used for microbe profiling. Currently, only blast is supported.

4.5.3 -mdb/mic_database viruses,bacteria,fungi,archaea

To set the microbial databases used in blast.

4.6 Function

4.6.1 -fun/-function

To open/close the function module.

4.6.2 -fd/-fun_diff_expr

To open/close the function of differential expression analysis.

4.6.3 -fdclass/-fun_diff_class A1,A2,...,An

To set the small RNAs that will be performed the differential expression analysis. The format is the same as the parameter -ac/-ann_class A1,A2,...,An.

4.6.4 -fdcase/-fun_diff_case ID1,ID2,...,IDn

To set the IDs of case samples.

4.6.5 -fdctrl/-fun_diff_control ID1,ID2,...,IDn

To set the IDs of control samples.

4.6.6 -fdtest/-fun_diff_test mwu

To set the statistic test between case and control samples. Currently, only Mann-Whitney U test is supported.

4.6.7 -fdmic/-fun_diff_mic

If added, COMPSRA will detect the annotation files of microbes. It is valid when running function module separately.

4.6.8 -fmtool/-fun_mtool blast

To set the tool that was used for microbe profiling. This parameter can facilitate COMPSRA to decide the input files.

4.6.9 -fmdb/-fun_mdb viruses,bacteria,fungi,archaea

To set the microbial databases used in blast. This parameter can facilitate COMPSRA to decide the input files.

4.6.10 -fdann/-fun_diff_ann

If added, COMPSRA will detect the annotation files of all small RNAs. It is valid when running function module separately.

4.6.11 -fm/-fun_merge

To open/close the function of merging.

4.6.12 -fms/-fun_merge_samples ID1,ID2,...,IDn

To extract read counts from each sample and merge them in one file by different kinds of small RNAs. The categories are set by the parameter -fdclass/-fun_diff_class A1,A2,...,An.

5 FAQ

5.0.1 How much memory does COMPSRA need?

COMPSRA does not cost lots of memory, but if STAR was taken as aligner, and 30G memory is considered at least for human genome.

About

COMPSRA: a COMprehensive Platform for Small RNA-Seq data Analysis

Resources

License

Stars

0 stars

Watchers

0 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

  • Java 100.0%