-
Notifications
You must be signed in to change notification settings - Fork 27
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
1 parent
9170a53
commit a38cdd8
Showing
7 changed files
with
194 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
## Unreleased | ||
|
||
Initial release for Nextclade v3! | ||
|
||
Read more about Nextclade datasets in the documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,23 @@ | ||
# Nextclade dataset for "dummy1" based on reference "DU1MMY" (.ignore/files) | ||
|
||
|
||
## Dataset attributes | ||
|
||
| attribute | value | | ||
| -------------------- | ---------------------------------------- | | ||
| name | dummy1 | | ||
| refName | DU1MMY | | ||
| refAccession | DU1MMY | | ||
|
||
|
||
## Authors and contacts | ||
|
||
Source code: | ||
|
||
Author1: | ||
|
||
Author2: | ||
|
||
## What is Nextclade dataset | ||
|
||
Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
#DUMMY | ||
ref dummy region 1 120 . + . ID=ref | ||
ref dummy CDS 1 15 . + 0 Name=HA1;gene=HA1 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,35 @@ | ||
{ | ||
"attributes": { | ||
"name": "dummy1", | ||
"refAccession": "DU1MMY", | ||
"refName": "DU1MMY" | ||
}, | ||
"cdsOrderPreference": [ | ||
"HA1" | ||
], | ||
"compatibility": { | ||
"cli": "3.0.0-alpha.0", | ||
"web": "3.0.0-alpha.0" | ||
}, | ||
"defaultCds": "HA1", | ||
"deprecated": false, | ||
"enabled": true, | ||
"experimental": true, | ||
"files": { | ||
"changelog": "CHANGELOG.md", | ||
"examples": "sequences.fasta", | ||
"genomeAnnotation": "genome_annotation.gff3", | ||
"pathogenJson": "pathogen.json", | ||
"readme": "README.md", | ||
"reference": "reference.fasta", | ||
"treeJson": "tree.json" | ||
}, | ||
"meta": { | ||
"bugs": "https://github.com/nextstrain/nextclade_data/issues", | ||
"source code": "https://github.com/nextstrain/nextclade_data" | ||
}, | ||
"schemaVersion": "3.0.0", | ||
"version": { | ||
"tag": "unreleased" | ||
} | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>Dummy1/Ref | ||
AAAAAAAAAAAAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,18 @@ | ||
>ref | ||
AAAAAAAAAAAAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>A | ||
GGAAAAAAAAAAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>A1 | ||
GAAAAAAGAAAAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>B1 | ||
AACCAACCAAAAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>B2 | ||
AACCAACCAAAAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>C | ||
AACAGAAAAAAAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>BC1 | ||
AACAAAAAAAGAAAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>BC2 | ||
AACAAAAAAAGATAAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG | ||
>BC3 | ||
AACAAAAAAAGATCAGTCGCTGATCGATCGGCTAGCTGCTCGATCGATCGGCTAGCTATTCATTTTCGATCTCCTCTCGCGATCGTATAGCTACGCATCGACTACTGCATCACTGACTTG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,108 @@ | ||
{ | ||
"meta": { | ||
"title": "Dummy nextclade reference tree", | ||
"data_provenance": [ | ||
{ | ||
"name": "fictional data" | ||
} | ||
] | ||
}, | ||
"tree": { | ||
"name": "NODE_0000000", | ||
"node_attrs": { | ||
"div": 0, | ||
"clade_membership": { | ||
"value": "unassigned" | ||
} | ||
}, | ||
"branch_attrs": { | ||
"mutations": { | ||
"nuc": [] | ||
} | ||
}, | ||
"children": [ | ||
{ | ||
"name": "A", | ||
"node_attrs": { | ||
"div": 0.016666666666666666, | ||
"clade_membership": { | ||
"value": "unassigned" | ||
} | ||
}, | ||
"branch_attrs": { | ||
"mutations": { | ||
"nuc": [ | ||
"A1G", | ||
"A2G" | ||
], | ||
"HA1": [ | ||
"K1G" | ||
] | ||
} | ||
}, | ||
"children": [] | ||
}, | ||
{ | ||
"name": "NODE_0000001", | ||
"node_attrs": { | ||
"div": 0.008333333333333333, | ||
"clade_membership": { | ||
"value": "unassigned" | ||
} | ||
}, | ||
"branch_attrs": { | ||
"mutations": { | ||
"nuc": [ | ||
"A3C" | ||
], | ||
"HA1": [ | ||
"K1N" | ||
] | ||
} | ||
}, | ||
"children": [ | ||
{ | ||
"name": "B", | ||
"node_attrs": { | ||
"div": 0.016666666666666666, | ||
"clade_membership": { | ||
"value": "unassigned" | ||
} | ||
}, | ||
"branch_attrs": { | ||
"mutations": { | ||
"nuc": [ | ||
"A4C" | ||
], | ||
"HA1": [ | ||
"K2Q" | ||
] | ||
} | ||
}, | ||
"children": [] | ||
}, | ||
{ | ||
"name": "C", | ||
"node_attrs": { | ||
"div": 0.016666666666666666, | ||
"clade_membership": { | ||
"value": "unassigned" | ||
} | ||
}, | ||
"branch_attrs": { | ||
"mutations": { | ||
"nuc": [ | ||
"A5G" | ||
], | ||
"HA1": [ | ||
"K2R" | ||
] | ||
} | ||
}, | ||
"children": [] | ||
} | ||
] | ||
} | ||
] | ||
} | ||
} |