-
Notifications
You must be signed in to change notification settings - Fork 27
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
1 parent
94503e7
commit eb6a908
Showing
15 changed files
with
1,508 additions
and
14 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
4 changes: 3 additions & 1 deletion
4
data_output/nextstrain/flu/h3n2/ha/CY163680/unreleased/CHANGELOG.md
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Binary file modified
BIN
+322 KB
(120%)
data_output/nextstrain/flu/h3n2/ha/CY163680/unreleased/dataset.zip
Binary file not shown.
2 changes: 1 addition & 1 deletion
2
data_output/nextstrain/flu/h3n2/ha/CY163680/unreleased/tree.json
Large diffs are not rendered by default.
Oops, something went wrong.
3 changes: 2 additions & 1 deletion
3
data_output/nextstrain/flu/h3n2/ha/EPI1857216/unreleased/CHANGELOG.md
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Binary file modified
BIN
+324 KB
(120%)
data_output/nextstrain/flu/h3n2/ha/EPI1857216/unreleased/dataset.zip
Binary file not shown.
2 changes: 1 addition & 1 deletion
2
data_output/nextstrain/flu/h3n2/ha/EPI1857216/unreleased/tree.json
Large diffs are not rendered by default.
Oops, something went wrong.
21 changes: 21 additions & 0 deletions
21
data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/CHANGELOG.md
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,21 @@ | ||
## Unreleased | ||
|
||
- update reference tree | ||
|
||
|
||
## 2024-11-05T09:19:52Z | ||
|
||
- update reference trees | ||
|
||
## 2024-04-19T07:50:39Z | ||
|
||
- addition of subclade [B.4.1](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/blob/main/subclades/B.4.1.yml) | ||
- addition of subclade [B.4.2](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/blob/main/subclades/B.4.2.yml) | ||
- addition of subclade [B.4.3](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/blob/main/subclades/B.4.3.yml) | ||
|
||
|
||
## 2024-01-16T20:31:02Z | ||
|
||
Initial release for Nextclade v3! | ||
|
||
Read more about Nextclade datasets in the documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html |
35 changes: 35 additions & 0 deletions
35
data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/README.md
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,35 @@ | ||
# Influenza A(H3N2) NA based on reference "A/Darwin/6/2021" | ||
|
||
| Key | Value | | ||
| -------------------- | -------------------- | | ||
| authors | [Richard Neher](https://neherlab.org), [Nextstrain](https://nextstrain.org) | | ||
| name | Influenza A H3N2 NA | | ||
| reference | A/Darwin/6/2021 | | ||
| dataset path | flu/h3n2/na/EPI1857215 | | ||
| reference accession | EPI1857215 | | ||
| clade definitions | [github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/) | | ||
|
||
|
||
|
||
## Features | ||
This dataset supports | ||
|
||
* Assignment to clades and subclades based on the nomenclature defined in [github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/) | ||
* Identification of glycosilation motifs | ||
* Counting of mutations in the RBD | ||
* Sequence QC | ||
* Phylogenetic placement | ||
|
||
## Clades of seasonal influenza viruses | ||
|
||
The WHO Collaborating centers **do not** define "clades" for the neuraminidase segment. | ||
|
||
This dataset focuses on "subclades" that in analogy to the HA segment are defined to break down diversity at high resolution and allow following the spread of different viral groups. | ||
These follow a Pango-like nomenclature consisting of a letter followed by a numbers separated by periods as in `C.1.2`. | ||
The leading letter is an alias of a previous name. | ||
Details of the nomenclature system can be found at [github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/). | ||
|
||
|
||
## What is Nextclade dataset | ||
|
||
Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html |
Binary file not shown.
4 changes: 4 additions & 0 deletions
4
data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/genome_annotation.gff3
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
##gff-version 3 | ||
##sequence-region EPI1857215 1 1439 | ||
EPI1857215 annotation remark 1 1439 . . . accessions=EPI1857215; | ||
EPI1857215 feature gene 8 1417 . + . codon_start=1;gene=NA;gene_name=NA;product=neuraminidase; |
122 changes: 122 additions & 0 deletions
122
data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/pathogen.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,122 @@ | ||
{ | ||
"schemaVersion": "3.0.0", | ||
"alignmentParams": { | ||
"excessBandwidth": 9, | ||
"terminalBandwidth": 100, | ||
"allowedMismatches": 4, | ||
"gapAlignmentSide": "right", | ||
"minSeedCover": 0.1 | ||
}, | ||
"compatibility": { | ||
"cli": "3.0.0-alpha.0", | ||
"web": "3.0.0-alpha.0" | ||
}, | ||
"defaultCds": "NA", | ||
"files": { | ||
"changelog": "CHANGELOG.md", | ||
"examples": "sequences.fasta", | ||
"genomeAnnotation": "genome_annotation.gff3", | ||
"pathogenJson": "pathogen.json", | ||
"readme": "README.md", | ||
"reference": "reference.fasta", | ||
"treeJson": "tree.json" | ||
}, | ||
"qc": { | ||
"privateMutations": { | ||
"enabled": true, | ||
"typical": 5, | ||
"cutoff": 15, | ||
"weightLabeledSubstitutions": 2, | ||
"weightReversionSubstitutions": 1, | ||
"weightUnlabeledSubstitutions": 1 | ||
}, | ||
"missingData": { | ||
"enabled": false, | ||
"missingDataThreshold": 100, | ||
"scoreBias": 10 | ||
}, | ||
"snpClusters": { | ||
"enabled": false, | ||
"windowSize": 100, | ||
"clusterCutOff": 5, | ||
"scoreWeight": 50 | ||
}, | ||
"mixedSites": { | ||
"enabled": true, | ||
"mixedSitesThreshold": 4 | ||
}, | ||
"frameShifts": { | ||
"enabled": true | ||
}, | ||
"stopCodons": { | ||
"enabled": true, | ||
"ignoredStopCodons": [] | ||
} | ||
}, | ||
"cdsOrderPreference": [ | ||
"NA" | ||
], | ||
"maintenance": { | ||
"website": [ | ||
"https://nextstrain.org", | ||
"https://clades.nextstrain.org" | ||
], | ||
"documentation": [ | ||
"https://github.com/nextstrain/seasonal-flu" | ||
], | ||
"source code": [ | ||
"https://github.com/nextstrain/seasonal_flu" | ||
], | ||
"issues": [ | ||
"https://github.com/nextstrain/seasonal_flu/issues" | ||
], | ||
"organizations": [ | ||
"Nextstrain" | ||
], | ||
"authors": [ | ||
"Nextstrain team <https://nextstrain.org>" | ||
] | ||
}, | ||
"nucMutLabelMap": {}, | ||
"nucMutLabelMapReverse": {}, | ||
"shortcuts": [ | ||
"flu_h3n2_na", | ||
"nextstrain/flu/h3n2/na", | ||
"nextstrain/flu/h3n2/na/darwin-6-2021" | ||
], | ||
"aaMotifs": [ | ||
{ | ||
"name": "glycosylation", | ||
"nameShort": "Glyc.", | ||
"nameFriendly": "Glycosylation", | ||
"description": "N-linked glycosylation motifs (N-X-S/T with X any amino acid other than P)", | ||
"includeCdses": [ | ||
{ | ||
"cds": "NA", | ||
"ranges": [ | ||
{ | ||
"begin": 33, | ||
"end": 470 | ||
} | ||
] | ||
} | ||
], | ||
"motifs": [ | ||
"N[^P][ST]" | ||
] | ||
} | ||
], | ||
"attributes": { | ||
"name": "Influenza A H3N2 NA", | ||
"segment": "na", | ||
"reference accession": "EPI1857215", | ||
"reference name": "A/Darwin/6/2021" | ||
}, | ||
"version": { | ||
"tag": "unreleased", | ||
"compatibility": { | ||
"cli": "3.0.0-alpha.0", | ||
"web": "3.0.0-alpha.0" | ||
} | ||
} | ||
} |
2 changes: 2 additions & 0 deletions
2
data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/reference.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>EPI1857215 | ||
AGTAAAGATGAATCCAAATCAAAAGATAATAACGATTGGCTCTGTTTCTCTCACAATTTCCACAATATGCTTCTTCATGCAAATTGCCATCCTGATAACTACTGTAACATTGCATTTCAAGCAATATGAATTCAACTCCCCCCCAAATAACCAAGTGATGCTGTGTGAACCAACAATAATAGAAAGAAACATAACAGAGATAGTGTATTTGACCAACACCACCATAGAGAAGGAAATATGCCCCAAACCAGCAGAATACAGAAATTGGTCAAAACCGCAATGTGGCATTACAGGATTTGCACCTTTCTCTAAGGACAATTCGATTAGGCTTTCCGCTGGTGGGGACATCTGGGTGACAAGAGAACCTTATGTGTCATGCGATCTTGACAAGTGTTATCAATTTGCCCTTGGACAGGGAACAACACTAAACAATGTGCATTCAAATAACACAGTACGTGATAGAACCCCTTATCGGACTCTATTGATGAATGAGTTGGGTGTTCCTTTCCATCTGGGGACCAAGCAAGTGTGCATAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGCTGCATGTTTGTATAACGGGGGATGATAAAAATGCAACTGCTAGCTTCATTTACAATGGGAGGCTTGTAGATAGTGTTGTTTCATGGTCCAACGATATTCTCAGAACCCAGGAGTCAGAATGCGTTTGTATCAATGGAACTTGTACAGTAGTAATGACTGATGGAAATGCTACAGGAAAAGCTGATACTAAAATACTATTCATTGAGGAGGGGAAAATCGTTCATACTAGCAAATTGTCAGGAAGTGCTCAGCATGTCGAAGAGTGCTCTTGCTATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGATCCAACCGGCCCATCATAGATATAAACATAAAGGATCATAGCATTGTTTCCAGGTATGTGTGTTCTGGACTTGTTGGAGACACACCCAGAAAAAGCGACAGCTCCAGCAGTAGCCATTGTTTGAACCCTAACAATGAAAAAGGTGATCATGGAGTGAAAGGCTGGGCCTTTGATGATGGAAATGACGTGTGGATGGGGAGAACAATCAACGAGACGTCACGCTTAGGGTATGAAACCTTCAAAGTCGTTGAAGGCTGGTCCAACCCTAAGTCCAAATTGCAGATAAATAGGCAAGTCATAGTTGACAGAGGCGATAGGTCCGGTTATTCTGGTATTTTCTCTGTTGAAGGCAAAAGCTGCATCAATCGGTGCTTTTATGTGGAGTTGATTAGGGGAAGAAAAGAGGAAACTGAAGTCTTGTGGACTTCAAACAGTATTGTTGTGTTTTGTGGCACCTCAGGTACATATGGAACAGGCTCATGGCCTGATGGGGCGAACCTCAGTCTCATGCATATATAAGCTTTCGCAATTTTAGAAAAAA |
Oops, something went wrong.