fix: add yam shortcuts for backwards compatibility

data/nextstrain/flu/yam/ha/JN993010/CHANGELOG.md

@@ -1,3 +1,7 @@
+## Unreleased
+
+Fix: Add shortcut paths to maintain backwards compatibility: i.e. one can request the dataset via `nextclade dataset get --name flu_yam_ha --output-dir dataset`, using the v2 path `flu_yam_ha`, instead of requiring the full v3 path `nextstrain/flu/yam/ha/JN993010`.
+
 ## 2024-01-16T20:31:02Z
 
 Initial release for Nextclade v3!

data/nextstrain/flu/yam/ha/JN993010/README.md

@@ -1,24 +1,25 @@
 # Nextclade dataset for "Influenza B Yam HA" based on reference "B/Wisconsin/01/2010" (flu/yam/ha/JN993010)
 
-| Key                  | Value                |
-| -------------------- | -------------------- |
-| authors                | [Richard Neher](https://neherlab.org), [Nextstrain](https://nextstrain.org)                         |
-| name                 | Influenza B(Yam) HA                      |
-| reference            | B/Wisconsin/01/2010                      |
-| dataset path         | flu/yam/ha/JN993010                     |
-| reference accession  | JN993010   |
+| Key                 | Value                                                                       |
+| ------------------- | --------------------------------------------------------------------------- |
+| authors             | [Richard Neher](https://neherlab.org), [Nextstrain](https://nextstrain.org) |
+| name                | Influenza B(Yam) HA                                                         |
+| reference           | B/Wisconsin/01/2010                                                         |
+| dataset path        | flu/yam/ha/JN993010                                                         |
+| reference accession | JN993010                                                                    |
 
 ## Scope of this dataset
-B/Yamagata viruses have not been observed since 2020. This dataset is provided for analysis of old sequences or suspected Yamagata sequences.
 
+B/Yamagata viruses have not been observed since 2020. This dataset is provided for analysis of old sequences or suspected Yamagata sequences.
 
 ## Features
+
 This dataset supports
 
- * Assignment to clades
- * Identification of glycosilation motifs
- * Sequence QC
- * Phylogenetic placement
+- Assignment to clades
+- Identification of glycosilation motifs
+- Sequence QC
+- Phylogenetic placement
 
 ## Clades of seasonal influenza viruses
 

data/nextstrain/flu/yam/ha/JN993010/pathogen.json

@@ -111,5 +111,11 @@
     "segment": "ha",
     "reference accession": "JN993010",
     "reference name": "B/Wisconsin/01/2010"
-  }
+  },
+  "shortcuts": [
+    "flu_yam_ha",
+    "nextstrain/flu/yam",
+    "nextstrain/flu/yam/ha",
+    "nextstrain/flu/yam/ha/wisconsin-1-2010"
+  ]
 }

data_output/index.json

@@ -993,6 +993,12 @@
         },
         {
           "path": "nextstrain/flu/yam/ha/JN993010",
+          "shortcuts": [
+            "flu_yam_ha",
+            "nextstrain/flu/yam",
+            "nextstrain/flu/yam/ha",
+            "nextstrain/flu/yam/ha/wisconsin-1-2010"
+          ],
           "enabled": true,
           "attributes": {
             "name": "Influenza B Yamagata HA",
@@ -1042,6 +1048,13 @@
             ]
           },
           "versions": [
+            {
+              "tag": "unreleased",
+              "compatibility": {
+                "cli": "3.0.0-alpha.0",
+                "web": "3.0.0-alpha.0"
+              }
+            },
             {
               "updatedAt": "2024-01-16T20:31:02Z",
               "tag": "2024-01-16--20-31-02Z",
@@ -1052,8 +1065,7 @@
             }
           ],
           "version": {
-            "updatedAt": "2024-01-16T20:31:02Z",
-            "tag": "2024-01-16--20-31-02Z",
+            "tag": "unreleased",
             "compatibility": {
               "cli": "3.0.0-alpha.0",
               "web": "3.0.0-alpha.0"

data_output/nextstrain/flu/yam/ha/JN993010/unreleased/CHANGELOG.md

@@ -0,0 +1,9 @@
+## Unreleased
+
+Fix: Add shortcut paths to maintain backwards compatibility: i.e. one can request the dataset via `nextclade dataset get --name flu_yam_ha --output-dir dataset`, using the v2 path `flu_yam_ha`, instead of requiring the full v3 path `nextstrain/flu/yam/ha/JN993010`.
+
+## 2024-01-16T20:31:02Z
+
+Initial release for Nextclade v3!
+
+Read more about Nextclade datasets in the documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data_output/nextstrain/flu/yam/ha/JN993010/unreleased/README.md

@@ -0,0 +1,31 @@
+# Nextclade dataset for "Influenza B Yam HA" based on reference "B/Wisconsin/01/2010" (flu/yam/ha/JN993010)
+
+| Key                 | Value                                                                       |
+| ------------------- | --------------------------------------------------------------------------- |
+| authors             | [Richard Neher](https://neherlab.org), [Nextstrain](https://nextstrain.org) |
+| name                | Influenza B(Yam) HA                                                         |
+| reference           | B/Wisconsin/01/2010                                                         |
+| dataset path        | flu/yam/ha/JN993010                                                         |
+| reference accession | JN993010                                                                    |
+
+## Scope of this dataset
+
+B/Yamagata viruses have not been observed since 2020. This dataset is provided for analysis of old sequences or suspected Yamagata sequences.
+
+## Features
+
+This dataset supports
+
+- Assignment to clades
+- Identification of glycosilation motifs
+- Sequence QC
+- Phylogenetic placement
+
+## Clades of seasonal influenza viruses
+
+The WHO Collaborating centers define "clades" as genetic groups of viruses with signature mutations to facilitate discussion of circulating diversity of the viruses.
+Clade demarcation do not always coincide with significantly different antigenic properties of the viruses.
+
+## What is Nextclade dataset
+
+Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data_output/nextstrain/flu/yam/ha/JN993010/unreleased/genome_annotation.gff3

@@ -0,0 +1,5 @@
+##gff-version 3
+##sequence-region JN993010.1 1 1755
+JN993010.1	feature	gene	1	45	.	+	.	gene_name="SigPep"
+JN993010.1	feature	gene	46	1083	.	+	.	gene_name="HA1"
+JN993010.1	feature	gene	1084	1755	.	+	.	gene_name="HA2"

data_output/nextstrain/flu/yam/ha/JN993010/unreleased/pathogen.json

@@ -0,0 +1,121 @@
+{
+  "schemaVersion": "3.0.0",
+  "alignmentParams": {
+    "excessBandwidth": 9,
+    "terminalBandwidth": 100,
+    "allowedMismatches": 4,
+    "gapAlignmentSide": "right",
+    "minSeedCover": 0.1
+  },
+  "compatibility": {
+    "cli": "3.0.0-alpha.0",
+    "web": "3.0.0-alpha.0"
+  },
+  "defaultCds": "HA1",
+  "files": {
+    "changelog": "CHANGELOG.md",
+    "examples": "sequences.fasta",
+    "genomeAnnotation": "genome_annotation.gff3",
+    "pathogenJson": "pathogen.json",
+    "readme": "README.md",
+    "reference": "reference.fasta",
+    "treeJson": "tree.json"
+  },
+  "qc": {
+    "privateMutations": {
+      "enabled": true,
+      "typical": 5,
+      "cutoff": 15,
+      "weightLabeledSubstitutions": 2,
+      "weightReversionSubstitutions": 1,
+      "weightUnlabeledSubstitutions": 1
+    },
+    "missingData": {
+      "enabled": false,
+      "missingDataThreshold": 100,
+      "scoreBias": 10
+    },
+    "snpClusters": {
+      "enabled": false,
+      "windowSize": 100,
+      "clusterCutOff": 5,
+      "scoreWeight": 50
+    },
+    "mixedSites": {
+      "enabled": true,
+      "mixedSitesThreshold": 4
+    },
+    "frameShifts": {
+      "enabled": true
+    },
+    "stopCodons": {
+      "enabled": true,
+      "ignoredStopCodons": []
+    }
+  },
+  "cdsOrderPreference": [
+    "HA1",
+    "HA2"
+  ],
+  "maintenance": {
+    "website": [
+      "https://nextstrain.org",
+      "https://clades.nextstrain.org"
+    ],
+    "documentation": [
+      "https://github.com/nextstrain/seasonal-flu"
+    ],
+    "source code": [
+      "https://github.com/nextstrain/seasonal_flu"
+    ],
+    "issues": [
+      "https://github.com/nextstrain/seasonal_flu/issues"
+    ],
+    "organizations": [
+      "Nextstrain"
+    ],
+    "authors": [
+      "Nextstrain team <https://nextstrain.org>"
+    ]
+  },
+  "nucMutLabelMap": {},
+  "nucMutLabelMapReverse": {},
+  "aaMotifs": [
+    {
+      "name": "glycosylation",
+      "nameShort": "Glyc.",
+      "nameFriendly": "Glycosylation",
+      "description": "N-linked glycosylation motifs (N-X-S/T with X any amino acid other than P)",
+      "includeCdses": [
+        {
+          "cds": "HA1",
+          "ranges": []
+        },
+        {
+          "cds": "HA2",
+          "ranges": [
+            {
+              "begin": 0,
+              "end": 186
+            }
+          ]
+        }
+      ],
+      "motifs": [
+        "N[^P][ST]"
+      ]
+    }
+  ],
+  "attributes": {
+    "name": "Influenza B Yamagata HA",
+    "segment": "ha",
+    "reference accession": "JN993010",
+    "reference name": "B/Wisconsin/01/2010"
+  },
+  "shortcuts": [
+    "flu_yam_ha",
+    "nextstrain/flu/yam",
+    "nextstrain/flu/yam/ha",
+    "nextstrain/flu/yam/ha/wisconsin-1-2010"
+  ]
+}

data_output/nextstrain/flu/yam/ha/JN993010/unreleased/reference.fasta

@@ -0,0 +1,2 @@
+>JN993010.1 Influenza B virus (B/Wisconsin/01/2010) segment 4 hemagglutinin (HA) gene, complete cds
+ATGAAGGCAATAATTGTACTACTCATGGTAGTAACATCCAATGCAGATCGAATCTGCACTGGGATAACATCTTCAAACTCACCTCATGTGGTCAAAACAGCTACTCAAGGGGAGGTCAATGTGACTGGCGTGATACCACTGACAACAACACCAACAAAATCTTATTTTGCAAATCTCAAAGGAACAAGGACCAGAGGGAAACTATGCCCGGACTGTCTCAACTGTACAGATCTGGATGTGGCCTTGGGCAGGCCAATGTGTGTGGGGACCACACCTTCTGCTAAAGCTTCAATACTCCACGAGGTCAGACCTGTTACATCCGGGTGCTTTCCTATAATGCACGACAGAACAAAAATCAGGCAACTACCCAATCTTCTCAGAGGATATGAAAATATCAGGTTATCAACCCAAAACGTTATCGATGCAGAAAAAGCACCAGGAGGACCCTACAGACTTGGAACCTCAGGATCTTGCCCTAACGCTACCAGTAAAATCGGATTTTTTGCAACAATGGCTTGGGCTGTCCCAAAGGACAACTACAAAAATGCAACGAACCCACTAACAGTAGAAGTACCATACATTTGTACAGAAGGGGAAGACCAAATTACTGTTTGGGGGTTCCATTCAGATAACAAAACCCAAATGAAGAGCCTCTATGGAGACTCAAATCCTCAAAAGTTCACCTCATCTGCTAATGGAGTAACCACACATTATGTTTCTCAGATTGGCGACTTCCCAGATCAAACAGAAGACGGAGGACTACCACAAAGCGGCAGAATTGTTGTTGATTACATGATGCAAAAACCTGGGAAAACAGGAACAATTGTCTATCAAAGAGGTGTTTTGTTGCCTCAAAAGGTGTGGTGCGCGAGTGGCAGGAGCAAAGTAATAAAAGGGTCATTGCCTTTAATTGGTGAAGCAGATTGCCTTCATGAAAAATACGGTGGATTAAACAAAAGCAAGCCTTACTACACAGGAGAACATGCAAAAGCCATAGGAAATTGCCCAATATGGGTAAAAACACCTTTGAAGCTTGCCAATGGAACCAAATATAGACCTCCTGCAAAACTATTGAAGGAAAGGGGTTTCTTCGGAGCTATTGCTGGTTTCCTAGAAGGAGGATGGGAAGGAATGATTGCAGGTTGGCACGGATACACATCTCACGGAGCACATGGAGTGGCAGTGGCGGCAGACCTTAAGAGTACACAAGAAGCTATAAATAAGATAACAAAAAATCTCAATTCTTTGAGTGAGCTAGAAGTAAAGAACCTTCAAAGACTAAGTGGTGCCATGGATGAACTCCACAACGAAATACTCGAGCTGGATGAGAAAGTGGATGATCTCAGAGCTGACACTATAAGCTCACAAATAGAACTTGCAGTCTTGCTTTCCAACGAAGGAATAATAAACAGTGAAGACGAGCATCTATTGGCACTTGAGAGAAAACTAAAGAAAATGCTGGGTCCCTCTGCTGTAGACATAGGAAACGGATGCTTCGAAACCAAACACAAATGCAACCAGACCTGCTTAGACAGGATAGCTGCTGGCACCTTTAATGCAGGAGAATTTTCTCTCCCCACTTTTGATTCATTGAACATTACTGCTGCATCTTTAAATGATGATGGATTGGATAACCATACTATACTGCTCTATTACTCAACTGCTGCTTCTAGTTTGGCTGTAACATTAATGCTAGCTATTTTTATTGTTTATATGGTCTCCAGAGACAACGTTTCATGCTCCATCTGTCTATAA