Merge pull request #249 from nextstrain/flu/add-proposals

flu: add additional H1/HA subclade proposal

data/nextstrain/flu/h1n1pdm/ha/CY121680/CHANGELOG.md

@@ -1,5 +1,6 @@
 ## Unreleased
- - include subclade proposals for C.1.9.a/b/c
+
+ - add subclade proposals C.1.9.a/b/c/d
 
 ## 2024-11-27T02:51:00Z
 

data/nextstrain/flu/h1n1pdm/ha/MW626062/CHANGELOG.md

@@ -1,5 +1,6 @@
 ## Unreleased
- - include subclade proposals for C.1.9.a/b/c
+
+ - add subclade proposals C.1.9.a/b/c/d
 
 ## 2024-11-27T02:51:00Z
 

data/nextstrain/flu/h3n2/ha/CY163680/CHANGELOG.md

@@ -1,5 +1,7 @@
 ## Unreleased
- - include subclade proposals for J.2.a/b/c
+
+ - include subclade proposals for J.2.a/b/c/d/e
+
 
 ## 2024-11-27T02:51:00Z
 

data/nextstrain/flu/h3n2/ha/EPI1857216/CHANGELOG.md

@@ -1,5 +1,6 @@
 ## Unreleased
- - include subclade proposals for J.2.a/b/c
+
+ - include subclade proposals for J.2.a/b/c/d/e
 
 ## 2024-11-27T02:51:00Z
 

data/nextstrain/flu/h3n2/na/EPI1857215/CHANGELOG.md

@@ -1,3 +1,8 @@
+## Unreleased
+
+ - update reference tree
+
+
 ## 2024-11-05T09:19:52Z
 
  - update reference trees

data_output/index.json

@@ -1004,7 +1004,7 @@
             "customClades": {
               "short-clade": 16,
               "subclade": 22,
-              "proposedSubclade": 25
+              "proposedSubclade": 26
             },
             "qc": [
               "privateMutations",
@@ -1219,11 +1219,11 @@
             "treeJson": "tree.json"
           },
           "capabilities": {
-            "clades": 36,
+            "clades": 37,
             "customClades": {
-              "subclade": 44,
-              "short-clade": 36,
-              "proposedSubclade": 47
+              "subclade": 45,
+              "short-clade": 37,
+              "proposedSubclade": 50
             },
             "qc": [
               "privateMutations",
@@ -1346,11 +1346,11 @@
             "treeJson": "tree.json"
           },
           "capabilities": {
-            "clades": 36,
+            "clades": 37,
             "customClades": {
-              "subclade": 44,
-              "short-clade": 36,
-              "proposedSubclade": 47
+              "subclade": 45,
+              "short-clade": 37,
+              "proposedSubclade": 50
             },
             "qc": [
               "privateMutations",
@@ -1496,6 +1496,13 @@
             ]
           },
           "versions": [
+            {
+              "tag": "unreleased",
+              "compatibility": {
+                "cli": "3.0.0-alpha.0",
+                "web": "3.0.0-alpha.0"
+              }
+            },
             {
               "updatedAt": "2024-11-05T09:19:52Z",
               "tag": "2024-11-05--09-19-52Z",
@@ -1522,8 +1529,7 @@
             }
           ],
           "version": {
-            "updatedAt": "2024-11-05T09:19:52Z",
-            "tag": "2024-11-05--09-19-52Z",
+            "tag": "unreleased",
             "compatibility": {
               "cli": "3.0.0-alpha.0",
               "web": "3.0.0-alpha.0"

data_output/nextstrain/flu/h1n1pdm/ha/CY121680/unreleased/CHANGELOG.md

@@ -1,5 +1,6 @@
 ## Unreleased
- - include subclade proposals for C.1.9.a/b/c
+
+ - add subclade proposals C.1.9.a/b/c/d
 
 ## 2024-11-27T02:51:00Z
 

data_output/nextstrain/flu/h1n1pdm/ha/MW626062/unreleased/CHANGELOG.md

@@ -1,5 +1,6 @@
 ## Unreleased
- - include subclade proposals for C.1.9.a/b/c
+
+ - add subclade proposals C.1.9.a/b/c/d
 
 ## 2024-11-27T02:51:00Z
 

data_output/nextstrain/flu/h3n2/ha/CY163680/unreleased/CHANGELOG.md

@@ -1,5 +1,7 @@
 ## Unreleased
- - include subclade proposals for J.2.a/b/c
+
+ - include subclade proposals for J.2.a/b/c/d/e
+
 
 ## 2024-11-27T02:51:00Z
 

data_output/nextstrain/flu/h3n2/ha/EPI1857216/unreleased/CHANGELOG.md

@@ -1,5 +1,6 @@
 ## Unreleased
- - include subclade proposals for J.2.a/b/c
+
+ - include subclade proposals for J.2.a/b/c/d/e
 
 ## 2024-11-27T02:51:00Z
 

data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/CHANGELOG.md

@@ -0,0 +1,21 @@
+## Unreleased
+
+ - update reference tree
+
+
+## 2024-11-05T09:19:52Z
+
+ - update reference trees
+
+## 2024-04-19T07:50:39Z
+
+- addition of subclade [B.4.1](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/blob/main/subclades/B.4.1.yml)
+- addition of subclade [B.4.2](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/blob/main/subclades/B.4.2.yml)
+- addition of subclade [B.4.3](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/blob/main/subclades/B.4.3.yml)
+
+
+## 2024-01-16T20:31:02Z
+
+Initial release for Nextclade v3!
+
+Read more about Nextclade datasets in the documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/README.md

@@ -0,0 +1,35 @@
+# Influenza A(H3N2) NA based on reference "A/Darwin/6/2021"
+
+| Key                  | Value                |
+| -------------------- | -------------------- |
+| authors                | [Richard Neher](https://neherlab.org), [Nextstrain](https://nextstrain.org)                         |
+| name                 | Influenza A H3N2 NA                      |
+| reference            | A/Darwin/6/2021                      |
+| dataset path         | flu/h3n2/na/EPI1857215                     |
+| reference accession  | EPI1857215   |
+| clade definitions  |  [github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/)  |
+
+
+
+## Features
+This dataset supports
+
+ * Assignment to clades and subclades based on the nomenclature defined in [github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/)
+ * Identification of glycosilation motifs
+ * Counting of mutations in the RBD
+ * Sequence QC
+ * Phylogenetic placement
+
+## Clades of seasonal influenza viruses
+
+The WHO Collaborating centers **do not** define "clades" for the neuraminidase segment.
+
+This dataset focuses on "subclades" that in analogy to the HA segment are defined to break down diversity at high resolution and allow following the spread of different viral groups.
+These follow a Pango-like nomenclature consisting of a letter followed by a numbers separated by periods as in `C.1.2`.
+The leading letter is an alias of a previous name.
+Details of the nomenclature system can be found at [github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_NA/).
+
+
+## What is Nextclade dataset
+
+Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/genome_annotation.gff3

@@ -0,0 +1,4 @@
+##gff-version 3
+##sequence-region EPI1857215 1 1439
+EPI1857215	annotation	remark	1	1439	.	.	.	accessions=EPI1857215;
+EPI1857215	feature	gene	8	1417	.	+	.	codon_start=1;gene=NA;gene_name=NA;product=neuraminidase;

data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/pathogen.json

@@ -0,0 +1,122 @@
+{
+  "schemaVersion": "3.0.0",
+  "alignmentParams": {
+    "excessBandwidth": 9,
+    "terminalBandwidth": 100,
+    "allowedMismatches": 4,
+    "gapAlignmentSide": "right",
+    "minSeedCover": 0.1
+  },
+  "compatibility": {
+    "cli": "3.0.0-alpha.0",
+    "web": "3.0.0-alpha.0"
+  },
+  "defaultCds": "NA",
+  "files": {
+    "changelog": "CHANGELOG.md",
+    "examples": "sequences.fasta",
+    "genomeAnnotation": "genome_annotation.gff3",
+    "pathogenJson": "pathogen.json",
+    "readme": "README.md",
+    "reference": "reference.fasta",
+    "treeJson": "tree.json"
+  },
+  "qc": {
+    "privateMutations": {
+      "enabled": true,
+      "typical": 5,
+      "cutoff": 15,
+      "weightLabeledSubstitutions": 2,
+      "weightReversionSubstitutions": 1,
+      "weightUnlabeledSubstitutions": 1
+    },
+    "missingData": {
+      "enabled": false,
+      "missingDataThreshold": 100,
+      "scoreBias": 10
+    },
+    "snpClusters": {
+      "enabled": false,
+      "windowSize": 100,
+      "clusterCutOff": 5,
+      "scoreWeight": 50
+    },
+    "mixedSites": {
+      "enabled": true,
+      "mixedSitesThreshold": 4
+    },
+    "frameShifts": {
+      "enabled": true
+    },
+    "stopCodons": {
+      "enabled": true,
+      "ignoredStopCodons": []
+    }
+  },
+  "cdsOrderPreference": [
+    "NA"
+  ],
+  "maintenance": {
+    "website": [
+      "https://nextstrain.org",
+      "https://clades.nextstrain.org"
+    ],
+    "documentation": [
+      "https://github.com/nextstrain/seasonal-flu"
+    ],
+    "source code": [
+      "https://github.com/nextstrain/seasonal_flu"
+    ],
+    "issues": [
+      "https://github.com/nextstrain/seasonal_flu/issues"
+    ],
+    "organizations": [
+      "Nextstrain"
+    ],
+    "authors": [
+      "Nextstrain team <https://nextstrain.org>"
+    ]
+  },
+  "nucMutLabelMap": {},
+  "nucMutLabelMapReverse": {},
+  "shortcuts": [
+    "flu_h3n2_na",
+    "nextstrain/flu/h3n2/na",
+    "nextstrain/flu/h3n2/na/darwin-6-2021"
+  ],
+  "aaMotifs": [
+    {
+      "name": "glycosylation",
+      "nameShort": "Glyc.",
+      "nameFriendly": "Glycosylation",
+      "description": "N-linked glycosylation motifs (N-X-S/T with X any amino acid other than P)",
+      "includeCdses": [
+        {
+          "cds": "NA",
+          "ranges": [
+            {
+              "begin": 33,
+              "end": 470
+            }
+          ]
+        }
+      ],
+      "motifs": [
+        "N[^P][ST]"
+      ]
+    }
+  ],
+  "attributes": {
+    "name": "Influenza A H3N2 NA",
+    "segment": "na",
+    "reference accession": "EPI1857215",
+    "reference name": "A/Darwin/6/2021"
+  },
+  "version": {
+    "tag": "unreleased",
+    "compatibility": {
+      "cli": "3.0.0-alpha.0",
+      "web": "3.0.0-alpha.0"
+    }
+  }
+}

data_output/nextstrain/flu/h3n2/na/EPI1857215/unreleased/reference.fasta

@@ -0,0 +1,2 @@
+>EPI1857215
+AGTAAAGATGAATCCAAATCAAAAGATAATAACGATTGGCTCTGTTTCTCTCACAATTTCCACAATATGCTTCTTCATGCAAATTGCCATCCTGATAACTACTGTAACATTGCATTTCAAGCAATATGAATTCAACTCCCCCCCAAATAACCAAGTGATGCTGTGTGAACCAACAATAATAGAAAGAAACATAACAGAGATAGTGTATTTGACCAACACCACCATAGAGAAGGAAATATGCCCCAAACCAGCAGAATACAGAAATTGGTCAAAACCGCAATGTGGCATTACAGGATTTGCACCTTTCTCTAAGGACAATTCGATTAGGCTTTCCGCTGGTGGGGACATCTGGGTGACAAGAGAACCTTATGTGTCATGCGATCTTGACAAGTGTTATCAATTTGCCCTTGGACAGGGAACAACACTAAACAATGTGCATTCAAATAACACAGTACGTGATAGAACCCCTTATCGGACTCTATTGATGAATGAGTTGGGTGTTCCTTTCCATCTGGGGACCAAGCAAGTGTGCATAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGCTGCATGTTTGTATAACGGGGGATGATAAAAATGCAACTGCTAGCTTCATTTACAATGGGAGGCTTGTAGATAGTGTTGTTTCATGGTCCAACGATATTCTCAGAACCCAGGAGTCAGAATGCGTTTGTATCAATGGAACTTGTACAGTAGTAATGACTGATGGAAATGCTACAGGAAAAGCTGATACTAAAATACTATTCATTGAGGAGGGGAAAATCGTTCATACTAGCAAATTGTCAGGAAGTGCTCAGCATGTCGAAGAGTGCTCTTGCTATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGATCCAACCGGCCCATCATAGATATAAACATAAAGGATCATAGCATTGTTTCCAGGTATGTGTGTTCTGGACTTGTTGGAGACACACCCAGAAAAAGCGACAGCTCCAGCAGTAGCCATTGTTTGAACCCTAACAATGAAAAAGGTGATCATGGAGTGAAAGGCTGGGCCTTTGATGATGGAAATGACGTGTGGATGGGGAGAACAATCAACGAGACGTCACGCTTAGGGTATGAAACCTTCAAAGTCGTTGAAGGCTGGTCCAACCCTAAGTCCAAATTGCAGATAAATAGGCAAGTCATAGTTGACAGAGGCGATAGGTCCGGTTATTCTGGTATTTTCTCTGTTGAAGGCAAAAGCTGCATCAATCGGTGCTTTTATGTGGAGTTGATTAGGGGAAGAAAAGAGGAAACTGAAGTCTTGTGGACTTCAAACAGTATTGTTGTGTTTTGTGGCACCTCAGGTACATATGGAACAGGCTCATGGCCTGATGGGGCGAACCTCAGTCTCATGCATATATAAGCTTTCGCAATTTTAGAAAAAA